998 resultados para Fruit trade.


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Over the last three decades, international agricultural trade has grown significantly. Technological advances in transportation logistics and storage have created opportunities to ship anything almost anywhere. Bilateral and multilateral trade agreements have also opened new pathways to an increasingly global market place. Yet, international agricultural trade is often constrained by differences in regulatory regimes. The impact of “regulatory asymmetry” is particularly acute for small and medium sized enterprises (SMEs) that lack resources and expertise to successfully operate in markets that have substantially different regulatory structures. As governments seek to encourage the development of SMEs, policy makers often confront the critical question of what ultimately motivates SME export behavior. Specifically, there is considerable interest in understanding how SMEs confront the challenges of regulatory asymmetry. Neoclassical models of the firm generally emphasize expected profit maximization under uncertainty, however these approaches do not adequately explain the entrepreneurial decision under regulatory asymmetry. Behavioral theories of the firm offer a far richer understanding of decision making by taking into account aspirations and adaptive performance in risky environments. This paper develops an analytical framework for decision making of a single agent. Considering risk, uncertainty and opportunity cost, the analysis focuses on the export behavior response of an SME in a situation of regulatory asymmetry. Drawing on the experience of fruit processor in Muzaffarpur, India, who must consider different regulatory environments when shipping fruit treated with sulfur dioxide, the study dissects the firm-level decision using @Risk, a Monte Carlo computational tool.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Agri-food supply chains extend beyond national boundaries, partially facilitated by a policy environment that encourages more liberal international trade. Rising concentration within the downstream sector has driven a shift towards “buyer-driven” global value chains (GVCs) extending internationally with global sourcing and the emergence of multinational key economic players that compete with increase emphasis on product quality attributes. Agri-food systems are thus increasingly governed by a range of inter-related public and private standards, both of which are becoming a priori mandatory, especially in supply chains for high-value and quality-differentiated agri-food products and tend to strongly affect upstream agricultural practices, firms’ internal organization and strategic behaviour and to shape the food chain organization. Notably, increasing attention has been given to the impact of SPS measures on agri-food trade and notably on developing countries’ export performance. Food and agricultural trade is the vital link in the mutual dependency of the global trade system and developing countries. Hence, developing countries derive a substantial portion of their income from food and agricultural trade. In Morocco, fruit and vegetable (especially fresh) are the primary agricultural export. Because of the labor intensity, this sector (especially citrus and tomato) is particularly important in terms of income and employment generation, especially for the female laborers hired in the farms and packing houses. Hence, the emergence of agricultural and agrifood product safety issues and the subsequent tightening of market requirements have challenged mutual gains due to the lack of technical and financial capacities of most developing countries.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Recent experiments revealed that the fruit fly Drosophila melanogaster has a dedicated mechanism for forgetting: blocking the G-protein Rac leads to slower and activating Rac to faster forgetting. This active form of forgetting lacks a satisfactory functional explanation. We investigated optimal decision making for an agent adapting to a stochastic environment where a stimulus may switch between being indicative of reward or punishment. Like Drosophila, an optimal agent shows forgetting with a rate that is linked to the time scale of changes in the environment. Moreover, to reduce the odds of missing future reward, an optimal agent may trade the risk of immediate pain for information gain and thus forget faster after aversive conditioning. A simple neuronal network reproduces these features. Our theory shows that forgetting in Drosophila appears as an optimal adaptive behavior in a changing environment. This is in line with the view that forgetting is adaptive rather than a consequence of limitations of the memory system.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This paper explores the potential usefulness of an AGE model with the Melitz-type trade specification to assess economic effects of technical regulations, taking the case of the EU ELV/RoHS directives as an example. Simulation experiments reveal that: (1) raising the fixed exporting cost to make sales in the EU market brings results that exports of the targeted commodities (motor vehicles and parts for ELV and electronic equipment for RoHS) to the EU from outside regions/countries expand while the domestic trade in the EU shrinks when the importer's preference for variety (PfV) is not strong; (2) if the PfV is not strong, policy changes that may bring reduction in the number of firms enable survived producers with high productivity to expand production to be large-scale mass producers fully enjoying the fruit of economies of scale; and (3) When the strength of the importer's PfV is changed from zero to unity, there is the value that totally changes simulation results and their interpretations.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Mode of access: Internet.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Litchi (Litchi chinensis Sonn.) is a subtropical to tropical fruit of high commercial value in international trade. However, harvested litchi fruit rapidly lose their bright red skin colour. Peel browning of harvested litchi fruit has largely been attributed to rapid degradation of red anthocyanin pigments. This process is associated with enzymatic oxidation of phenolics by polyphenol oxidase (PPO) and/or peroxidase (POD). PRO and POD from litchi pericarp cannot directly oxidize anthocyanins. Moreover, PPO substrates in the pericarp are not well characterised. Consequently, the roles of PPO and POD in litchi browning require further investigation. Recently, an anthocyanase catalysing the hydrolysis of sugar moieties from anthocyanin to anthocyanidin has been identified in litchi peel for the first time. Thus, litchi enzymatic browning may involve an anthocyanase-anthocyanin-phenolic-PPO reaction. Current research focus is on characterising the properties of the anthocyanase involved in anthocyanin degradation. Associated emphasis is on maintenance of membrane functions in relation to loss of compartmentation between litchi peel oxidase enzymes and their substrates. (C) 2004 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Wild animals have been kept as pets for centuries, in Brazil companionship is one of the main reasons why wild species are legally bred and traded. This paper is an attempt to call the attention for problems concerning the welfare of wild pets involved in the trading system in Brazil. Some issues presented are: a) the significant increase in the number of wildlife breeders and traders and the difficulties faced by of the Brazilian government in controlling this activity; b) the main welfare issues faced by breeders and owners of wild pets; and c) the destination of wild pets no longer wanted. Finally, some recommendations are made having the welfare of the animals as a priority.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.