858 resultados para Fruit damage
Resumo:
It is well known that long term use of shampoo causes damage to human hair. Although the Lowry method has been widely used to quantify hair damage, it is unsuitable to determine this in the presence of some surfactants and there is no other method proposed in literature. In this work, a different method is used to investigate and compare the hair damage induced by four types of surfactants (including three commercial-grade surfactants) and water. Hair samples were immersed in aqueous solution of surfactants under conditions that resemble a shower (38 °C, constant shaking). These solutions become colored with time of contact with hair and its UV-vis spectra were recorded. For comparison, the amount of extracted proteins from hair by sodium dodecyl sulfate (SDS) and by water were estimated by the Lowry method. Additionally, non-pigmented vs. pigmented hair and also sepia melanin were used to understand the washing solution color and their spectra. The results presented herein show that hair degradation is mostly caused by the extraction of proteins, cuticle fragments and melanin granules from hair fiber. It was found that the intensity of solution color varies with the charge density of the surfactants. Furthermore, the intensity of solution color can be correlated to the amount of proteins quantified by the Lowry method as well as to the degree of hair damage. UV-vis spectrum of hair washing solutions is a simple and straightforward method to quantify and compare hair damages induced by different commercial surfactants.
Resumo:
Resistant hypertension (RHTN) includes patients with controlled blood pressure (BP) (CRHTN) and uncontrolled BP (UCRHTN). In fact, RHTN patients are more likely to have target organ damage (TOD), and resistin, leptin and adiponectin may affect BP control in these subjects. We assessed the relationship between adipokines levels and arterial stiffness, left ventricular hypertrophy (LVH) and microalbuminuria (MA). This cross-sectional study included CRHTN (n=51) and UCRHTN (n=38) patients for evaluating body mass index, ambulatory blood pressure monitoring, plasma adiponectin, leptin and resistin concentrations, pulse wave velocity (PWV), MA and echocardiography. Leptin and resistin levels were higher in UCRHTN, whereas adiponectin levels were lower in this same subgroup. Similarly, arterial stiffness, LVH and MA were higher in UCRHTN subgroup. Adiponectin levels negatively correlated with PWV (r=-0.42, P<0.01), and MA (r=-0.48, P<0.01) only in UCRHTN. Leptin was positively correlated with PWV (r=0.37, P=0.02) in UCRHTN subgroup, whereas resistin was not correlated with TOD in both subgroups. Adiponectin is associated with arterial stiffness and renal injury in UCRHTN patients, whereas leptin is associated with arterial stiffness in the same subgroup. Taken together, our results showed that those adipokines may contribute to vascular and renal damage in UCRHTN patients.
Resumo:
Monte Carlo track structures (MCTS) simulations have been recognized as useful tools for radiobiological modeling. However, the authors noticed several issues regarding the consistency of reported data. Therefore, in this work, they analyze the impact of various user defined parameters on simulated direct DNA damage yields. In addition, they draw attention to discrepancies in published literature in DNA strand break (SB) yields and selected methodologies. The MCTS code Geant4-DNA was used to compare radial dose profiles in a nanometer-scale region of interest (ROI) for photon sources of varying sizes and energies. Then, electron tracks of 0.28 keV-220 keV were superimposed on a geometric DNA model composed of 2.7 × 10(6) nucleosomes, and SBs were simulated according to four definitions based on energy deposits or energy transfers in DNA strand targets compared to a threshold energy ETH. The SB frequencies and complexities in nucleosomes as a function of incident electron energies were obtained. SBs were classified into higher order clusters such as single and double strand breaks (SSBs and DSBs) based on inter-SB distances and on the number of affected strands. Comparisons of different nonuniform dose distributions lacking charged particle equilibrium may lead to erroneous conclusions regarding the effect of energy on relative biological effectiveness. The energy transfer-based SB definitions give similar SB yields as the one based on energy deposit when ETH ≈ 10.79 eV, but deviate significantly for higher ETH values. Between 30 and 40 nucleosomes/Gy show at least one SB in the ROI. The number of nucleosomes that present a complex damage pattern of more than 2 SBs and the degree of complexity of the damage in these nucleosomes diminish as the incident electron energy increases. DNA damage classification into SSB and DSB is highly dependent on the definitions of these higher order structures and their implementations. The authors' show that, for the four studied models, different yields are expected by up to 54% for SSBs and by up to 32% for DSBs, as a function of the incident electrons energy and of the models being compared. MCTS simulations allow to compare direct DNA damage types and complexities induced by ionizing radiation. However, simulation results depend to a large degree on user-defined parameters, definitions, and algorithms such as: DNA model, dose distribution, SB definition, and the DNA damage clustering algorithm. These interdependencies should be well controlled during the simulations and explicitly reported when comparing results to experiments or calculations.
Resumo:
Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.
Resumo:
To characterize cumulative joint damage (CJD) patterns in rheumatoid arthritis (RA) and determine their associations with demographic/clinical features and HLA-DRB1 gene polymorphism. Hand and foot radiographs were obtained from 404 patients with RA. CJD patterns were determined by 3 derivations from Sharp/van der Heijde scores, obtained by the mathematical division of scores for hands/feet (Sharp-h/f score), fingers/wrists (Sharp-f/w score), and erosion/space narrowing (Sharp-e/sn score), respectively. DNA and serum were obtained for determination of HLA-DRB1 polymorphism, rheumatoid factor (RF), and anticitrullinated protein antibodies (ACPA). Patients with wrist-dominant CJD pattern were more likely to have severe RA than those with finger-dominant pattern (68.4% vs 46.0%; p = 0.036) as were those with foot-dominant vs hand-dominant CJD pattern (76.5% vs 56.4%; p = 0.044). HLA-DRB1 shared epitope (SE) alleles were associated with erosion-dominant CJD pattern (p = 0.021). Patients with erosion-dominant CJD pattern had higher levels of RF and ACPA than those with space-narrowing-dominant CJD pattern (median RF 71.35 U/ml vs 22.05 U/ml, respectively; p = 0.003; median ACPA 187.9 U/ml vs 143.2 U/ml, respectively; p < 0.001). The majority of triple-positive patients (SE+, RF+, ACPA+) had erosion-dominant CJD pattern (62.3%) while the majority of triple-negative patients (SE-, FR-, ACPA-) had space narrowing-dominant CJD pattern (75%; p = 0.017). ACPA was associated with HLA-DRB1 SE alleles (p < 0.05). Patients with foot-dominant CJD pattern were taller than those with hand-dominant CJD pattern (p = 0.002); those with erosion-dominant CJD pattern had higher weight and body mass index than those with space narrowing-dominant CJD pattern (p = 0.014, p = 0.001). CJD patterns were associated with disease severity, HLA-DRB1 SE status, presence and titer of ACPA and RF, and morphometric features.
Resumo:
Rubus niveus Thunb. plant belongs to Rosaceae family and have been used traditionally to treat wounds, burns, inflammation, dysentery, diarrhea and for curing excessive bleeding during menstrual cycle. The present study was undertaken to investigate the in vivo genotoxicity of Rubus niveus aerial parts extract and its possible chemoprotection on doxorubicin (DXR)-induced DNA damage. In parallel, the main phytochemicals constituents in the extract were determined. The animals were exposed to the extract for 24 and 48h, and the doses selected were 500, 1000 and 2000mg/kg b.w. administered by gavage alone or prior to DXR (30mg/kg b.w.) administered by intraperitoneal injection. The endpoints analyzed were DNA damage in bone marrow and peripheral blood cells assessed by the alkaline alkaline (pH>13) comet assay and bone marrow micronucleus test. The results of chemical analysis of the extract showed the presence of tormentic acid, stigmasterol, quercitinglucoronide (miquelianin) and niga-ichigoside F1 as main compounds. Both cytogenetic endpoints analyzed showed that there were no statistically significant differences (p>0.05) between the negative control and the treated groups with the two higher doses of Rubus niveus extract alone, demonstrating absence of genotoxic and mutagenic effects. Aneugenic/clastogenic effect was observed only at 2000mg/kg dose. On the other hand, in the both assays and all tested doses were observed a significant reduction of DNA damage and chromosomal aberrations in all groups co-treated with DXR and extract compared to those which received only DXR. These results indicate that Rubus niveus aerial parts extract did not revealed any genotoxic effect, but presented some aneugenic/clastogenic effect at higher dose; and suggest that it could be a potential adjuvant against development of second malignant neoplasms caused by the cancer chemotherapic DXR.
Resumo:
Oxidative stress and inflammatory processes strongly contribute to pathogenesis in Duchenne muscular dystrophy (DMD). Based on evidence that excess iron may increase oxidative stress and contribute to the inflammatory response, we investigated whether deferoxamine (DFX), a potent iron chelating agent, reduces oxidative stress and inflammation in the diaphragm (DIA) muscle of mdx mice (an experimental model of DMD). Fourteen-day-old mdx mice received daily intraperitoneal injections of DFX at a dose of 150 mg/kg body weight, diluted in saline, for 14 days. C57BL/10 and control mdx mice received daily intraperitoneal injections of saline only, for 14 days. Grip strength was evaluated as a functional measure, and blood samples were collected for biochemical assessment of muscle fiber degeneration. In addition, the DIA muscle was removed and processed for histopathology and Western blotting analysis. In mdx mice, DFX reduced muscle damage and loss of muscle strength. DFX treatment also resulted in a significant reduction of dystrophic inflammatory processes, as indicated by decreases in the inflammatory area and in NF-κB levels. DFX significantly decreased oxidative damage, as shown by lower levels of 4-hydroxynonenal and a reduction in dihydroethidium staining in the DIA muscle of mdx mice. The results of the present study suggest that DFX may be useful in therapeutic strategies to ameliorate dystrophic muscle pathology, possibly via mechanisms involving oxidative and inflammatory pathways.
Resumo:
Neks are serine-threonine kinases that are similar to NIMA, a protein found in Aspergillus nidulans which is essential for cell division. In humans there are eleven Neks which are involved in different biological functions besides the cell cycle control. Nek4 is one of the largest members of the Nek family and has been related to the primary cilia formation and in DNA damage response. However, its substrates and interaction partners are still unknown. In an attempt to better understand the role of Nek4, we performed an interactomics study to find new biological processes in which Nek4 is involved. We also described a novel Nek4 isoform which lacks a region of 46 amino acids derived from an insertion of an Alu sequence and showed the interactomics profile of these two Nek4 proteins. Isoform 1 and isoform 2 of Nek4 were expressed in human cells and after an immunoprecipitation followed by mass spectrometry, 474 interacting proteins were identified for isoform 1 and 149 for isoform 2 of Nek4. About 68% of isoform 2 potential interactors (102 proteins) are common between the two Nek4 isoforms. Our results reinforce Nek4 involvement in the DNA damage response, cilia maintenance and microtubule stabilization, and raise the possibility of new functional contexts, including apoptosis signaling, stress response, translation, protein quality control and, most intriguingly, RNA splicing. We show for the first time an unexpected difference between both Nek4 isoforms in RNA splicing control. Among the interacting partners, we found important proteins such as ANT3, Whirlin, PCNA, 14-3-3ε, SRSF1, SRSF2, SRPK1 and hNRNPs proteins. This study provides new insights into Nek4 functions, identifying new interaction partners and further suggests an interesting difference between isoform 1 and isoform 2 of this kinase. Nek4 isoform 1 may have similar roles compared to other Neks and these roles are not all preserved in isoform 2. Besides, in some processes, both isoforms showed opposite effects, indicating a possible fine controlled regulation.
Resumo:
Machado-Joseph disease (SCA3) is the most frequent spinocerebellar ataxia worldwide and characterized by remarkable phenotypic heterogeneity. MRI-based studies in SCA3 focused in the cerebellum and connections, but little is known about cord damage in the disease and its clinical relevance. To evaluate the spinal cord damage in SCA3 through quantitative analysis of MRI scans. A group of 48 patients with SCA3 and 48 age and gender-matched healthy controls underwent MRI on a 3T scanner. We used T1-weighted 3D images to estimate the cervical spinal cord area (CA) and eccentricity (CE) at three C2/C3 levels based on a semi-automatic image segmentation protocol. The scale for assessment and rating of ataxia (SARA) was employed to quantify disease severity. The two groups-SCA3 and controls-were significantly different regarding CA (49.5 ± 7.3 vs 67.2 ± 6.3 mm(2), p < 0.001) and CE values (0.79 ± 0.06 vs 0.75 ± 0.05, p = 0.005). In addition, CA presented a significant correlation with SARA scores in the patient group (p = 0.010). CE was not associated with SARA scores (p = 0.857). In the multiple variable regression, we found that disease duration was the only variable associated with CA (coefficient = -0.629, p = 0.025). SCA3 is characterized by cervical cord atrophy and antero-posterior flattening. In addition, the spinal cord areas did correlate with disease severity. This suggests that quantitative analyses of the spinal cord MRI might be a useful biomarker in SCA3.
Resumo:
In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.
Resumo:
Excessive and inadequate handling of fruits and vegetables provides high incidences of physical damage, consequently, post harvest losses. The main goal of this work was to evaluate the impact magnitude in persimmon packing lines, Rama Forte, and to determine, at the laboratory, its impact limits. For evaluating the critical points it was used an instrumented sphere of 76 mm of diameter (Technmark, Inc, Lansing, USA), which registered the impact magnitude in seven distinctive impact lines located in four packing houses. For determining physical damages, tests were carried out at the laboratory, where fruit drop was related to impact magnitude, physical damage incidence and fruit post harvest losses. At the packing lines, the values found varied from 21 to 87 G on the transfer points and the majority of registered impacts (over 94%) were down 50G. Drops from 20 cm caused an increase in weight losses after six days of storage at room temperature. Drops from 20 and 30 cm caused skin darkness (low L values), associated to a decrease in color intensity (chroma). Impact drop did not affect pulp fruit chemical features.
Resumo:
The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.
Resumo:
Losses of horticulture product in Brazil are significant and among the main causes are the use of inappropriate boxes and the absence of a cold chain. A project for boxes is proposed, based on computer simulations, optimization and experimental validation, trying to minimize the amount of wood associated with structural and ergonomic aspects and the effective area of the openings. Three box prototypes were designed and built using straight laths with different configurations and areas of openings (54% and 36%). The cooling efficiency of Tommy Atkins mango (Mangifera Indica L.) was evaluated by determining the cooling time for fruit packed in the wood models and packed in the commercially used cardboard boxes, submitted to cooling in a forced-air system, at a temperature of 6ºC and average relative humidity of 85.4±2.1%. The Finite Element Method was applied, for the dimensioning and structural optimization of the model with the best behavior in relation to cooling. All wooden boxes with fruit underwent vibration testing for two hours (20 Hz). There was no significant difference in average cooling time in the wooden boxes (36.08±1.44 min); however, the difference was significant in comparison to the cardboard boxes (82.63±29.64 min). In the model chosen for structural optimization (36% effective area of openings and two side laths), the reduction in total volume of material was 60% and 83% in the cross section of the columns. There was no indication of mechanical damage in the fruit after undergoing the vibration test. Computer simulations and structural study may be used as a support tool for developing projects for boxes, with geometric, ergonomic and thermal criteria.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física