970 resultados para Fragile-X syndrome


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Amyotrophic lateral sclerosis (ALS) is a progressive motor neuron disease, fatal within 1 to 5 years after onset of symptoms. About 3 out of 100’000 persons are diagnosed with ALS and there is still no cure available [1, 2]. 95% of all cases occur sporadically and the aetiology remains largely unknown [3]. However, up to now 16 genes were identified to play a role in the development of familial ALS. One of these genes is FUS that encodes for the protein fused in sarcoma (FUS). Mutations in this gene are responsible for some cases of sporadic as well as of inherited ALS [4]. FUS belongs to the family of heterogeneous nuclear ribonucleoproteins and is predicted to be involved in several cellular functions like transcription regulation, RNA splicing, mRNA transport in neurons and microRNA processing [5] Aberrant accumulation of mutated FUS has been found in the cytoplasm of motor neurons from ALS patients [6]. The mislocalization of FUS is based on a mutation in the nuclear localization signal of FUS [7]. However, it is still unclear if the cytoplasmic localization of FUS leads to a toxic gain of cytoplasmic function and/or a loss of nuclear function that might be crucial in the course of ALS. The goal of this project is to characterize the impact of ALS-associated FUS mutations on in vitro differentiated motor neurons. To this end, we edit the genome of induced pluripotent stem cells (iPSC) using transcription activator-like effector nucleases (TALENs) [8,9] to create three isogenic cell lines, each carrying an ALS-associated FUS mutation (G156E, R244C and P525L). These iPSC’s will then be differentiated to motor neurons according to a recently established protocol [10] and serve to study alterations in the transcriptome, proteome and metabolome upon the expression of ALS-associated FUS. With this approach, we hope to unravel the molecular mechanism leading to FUS-associated ALS and to provide new insight into the emerging connection between misregulation of RNA metabolism and neurodegeneration, a connection that is currently implied in a variety of additional neurological diseases, including spinocerebellar ataxia 2 (SCA-2), spinal muscular atrophy (SMA), fragile X syndrome, and myotonic dystrophy. [1] Cleveland, D.W. et al. (2001) Nat Rev Neurosci 2(11): 806-819 [2] Sathasivam, S. (2010) Singapore Med J 51(5): 367-372 [3] Schymick, J.C. et al. (2007) Hum Mol Genet Vol 16: 233-242 [4] Pratt, A.J. et al. (2012). Degener Neurol Neuromuscul Dis 2012(2): 1-14 [5] Lagier-Tourenne, C. Hum Mol Genet, 2010. 19(R1): p. R46-64 [6] Mochizuki, Y. et al. (2012) J Neurol Sci 323(1-2): 85-92 [7] Dormann, D. et al. (2010) EMBO J 29(16): 2841-2857 [8] Hockemeyer, D. et al. (2011) Nat Biotech 29(8): 731-734 [9] Joung, J.K. and J.D. Sander (2013) Nat Rev Mol Cell Biol 14(1): 49-55 [10]Amoroso, M.W. et al. (2013) J Neurosci 33(2): 574-586.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Genetic anticipation is defined as a decrease in age of onset or increase in severity as the disorder is transmitted through subsequent generations. Anticipation has been noted in the literature for over a century. Recently, anticipation in several diseases including Huntington's Disease, Myotonic Dystrophy and Fragile X Syndrome were shown to be caused by expansion of triplet repeats. Anticipation effects have also been observed in numerous mental disorders (e.g. Schizophrenia, Bipolar Disorder), cancers (Li-Fraumeni Syndrome, Leukemia) and other complex diseases. ^ Several statistical methods have been applied to determine whether anticipation is a true phenomenon in a particular disorder, including standard statistical tests and newly developed affected parent/affected child pair methods. These methods have been shown to be inappropriate for assessing anticipation for a variety of reasons, including familial correlation and low power. Therefore, we have developed family-based likelihood modeling approaches to model the underlying transmission of the disease gene and penetrance function and hence detect anticipation. These methods can be applied in extended families, thus improving the power to detect anticipation compared with existing methods based only upon parents and children. The first method we have proposed is based on the regressive logistic hazard model. This approach models anticipation by a generational covariate. The second method allows alleles to mutate as they are transmitted from parents to offspring and is appropriate for modeling the known triplet repeat diseases in which the disease alleles can become more deleterious as they are transmitted across generations. ^ To evaluate the new methods, we performed extensive simulation studies for data simulated under different conditions to evaluate the effectiveness of the algorithms to detect genetic anticipation. Results from analysis by the first method yielded empirical power greater than 87% based on the 5% type I error critical value identified in each simulation depending on the method of data generation and current age criteria. Analysis by the second method was not possible due to the current formulation of the software. The application of this method to Huntington's Disease and Li-Fraumeni Syndrome data sets revealed evidence for a generation effect in both cases. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The molecular mechanisms responsible for the expansion and deletion of trinucleotide repeat sequences (TRS) are the focus of our studies. Several hereditary neurological diseases including Huntington's disease, myotonic dystrophy, and fragile X syndrome are associated with the instability of TRS. Using the well defined and controllable model system of Escherichia coli, the influences of three types of DNA incisions on genetic instability of CTG•CAG repeats were studied: DNA double-strand breaks (DSB), single-strand nicks, and single-strand gaps. The DNA incisions were generated in pUC19 derivatives by in vitro cleavage with restriction endonucleases. The cleaved DNA was then transformed into E. coli parental and mutant strains. Double-strand breaks induced deletions throughout the TRS region in an orientation dependent manner relative to the origin of replication. The extent of instability was enhanced by the repeat length and sequence (CTG•CAG vs. CGG•CCG). Mutations in recA and recBC increased deletions, mutations in recF stabilized the TRS, whereas mutations in ruvA had no effect. DSB were repaired by intramolecular recombination, versus an intermolecular gene conversion or crossover mechanism. 30 nt gaps formed a distinct 30 nt deletion product, whereas single strand nicks and gaps of 15 nts did not induce expansions or deletions. Formation of this deletion product required the CTG•CAG repeats to be present in the single-stranded region and was stimulated by E. coli DNA ligase, but was not dependent upon the RecFOR pathway. Models are presented to explain the DSB induced instabilities and formation of the 30 nucleotide deletion product. In addition to the in vitro creation of DSBs, several attempts to generate this incision in vivo with the use of EcoR I restriction modification systems were conducted. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Friedreich’s ataxia, the most frequent inherited ataxia, is caused, in the vast majority of cases, by large GAA repeat expansions in the first intron of the frataxin gene. The normal sequence corresponds to a moderately polymorphic trinucleotide repeat with bimodal size distribution. Small normal alleles have approximately eight to nine repeats whereas a more heterogeneous mode of large normal alleles ranges from 16 to 34 GAA. The latter class accounts for ≈17% of normal alleles. To identify the origin of the expansion mutation, we analyzed linkage disequilibrium between expansion mutations or normal alleles and a haplotype of five polymorphic markers within or close to the frataxin gene; 51% of the expansions were associated with a single haplotype, and the other expansions were associated with haplotypes that could be related to the major one by mutation at a polymorphic marker or by ancient recombination. Of interest, the major haplotype associated with expansion is also the major haplotype associated with the larger alleles in the normal size range and was almost never found associated with the smaller normal alleles. The results indicate that most if not all large normal alleles derive from a single founder chromosome and that they represent a reservoir for larger expansion events, possibly through “premutation” intermediates. Indeed, we found two such alleles (42 and 60 GAA) that underwent cataclysmic expansion to pathological range in a single generation. This stepwise evolution to large trinucleotide expansions already was suggested for myotonic dystrophy and fragile X syndrome and may relate to a common mutational mechanism, despite sequence motif differences.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Gene targeting allows precise, predetermined changes to be made in a chosen gene in the mouse genome. To date, targeting has been used most often for generation of animals completely lacking the product of a gene of interest. The resulting "knockout" mice have confirmed some hypotheses, have upset others, but have rarely been uninformative. Models of several human genetic diseases have been produced by targeting--including Gaucher disease, cystic fibrosis, and the fragile X syndrome. These diseases are primarily determined by defects in single genes, and their modes of inheritance are well understood. When the disease under study has a complex etiology with multiple genetic and environmental components, the generation of animal models becomes more difficult but no less valuable. The problems associated with dissecting out the individual genetic factors also increases substantially and the distinction between causation and correlation is often difficult. To prove causation in a complex system requires rigorous adherence to the principle that the experiments must allow detection of the effects of changing only a single variable at one time. Gene targeting experiments, when properly designed, can test the effects of a precise genetic change completely free from the effects of differences in any other genes (linked or unlinked to the test gene). They therefore allow proofs of causation.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

An n-allele model is developed for the FMR1 locus, which causes the fragile X syndrome, where n is the number of triplet repeats in the first exon. Frequencies in the general population and in index families are used to generate an n to n + delta transition matrix that predicts specific risks in satisfactory agreement with observation. However, until sequencing distinguishes between stable and unstable alleles with the same value of n, it is premature to infer whether allelic frequencies at the FMR1 locus are at equilibrium or, as some have suggested, are evolving toward higher frequencies of the pathogenic allele.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fragile X syndrome (FXS) is the most common form of inherited mental retardation in humans. FXS is caused by loss of the Fragile X Mental Retardation Protein (FMRP), an important regulator of neuronal mRNA translation. Patients with FXS display cognitive deficits including memory problems. Protein synthesis-dependent long-term changes in synaptic plasticity are involved in the establishment and maintenance of long-term memory. One prevalent theory of FXS pathology predicts that FMRP is required to negatively regulate the translation of important mRNAs at the synapse. We are investigating microRNAs (miRNAs) as a potential regulator of synaptic FMRP-regulated mRNAs that have previously been described as being crucial to the process of synaptic plasticity. The general hypothesis underlying this thesis is that FMRP may negatively regulate the expression of futsch (the Drosophila homologue of the microtubule-associated protein gene MAP1B) via the miRNA pathway. The first step we took in testing this hypothesis was to confirm that futsch is subject to miRNA-mediated translational control. Using in silico target analysis, we predicted that several neuronally expressed miRNAs target the futsch mRNA 3'UTR and repress expression of Futsch protein. Then, using an in vitro luciferase reporter system, we showed that miR-315 and members of the miR-9 family selectively down-regulated futsch reporter translation. We have confirmed by site- directed mutagenesis that the miRNA interaction with the futsch 3'UTR is specific to the miRNA seed region binding site. Interestingly, reduction of FMRP levels by RNAi had no effect on futsch 3'UTR reporter expression. Together, these data suggest regulation of futsch expression by the miRNA pathway might be independent of FMRP activity. However, additional experiments need to be completed to confirm these preliminary results.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This review summarizes evidence of dysregulated reward circuitry function in a range of neurodevelopmental and psychiatric disorders and genetic syndromes. First, the contribution of identifying a core mechanistic process across disparate disorders to disease classification is discussed, followed by a review of the neurobiology of reward circuitry. We next consider preclinical animal models and clinical evidence of reward-pathway dysfunction in a range of disorders, including psychiatric disorders (i.e., substance-use disorders, affective disorders, eating disorders, and obsessive compulsive disorders), neurodevelopmental disorders (i.e., schizophrenia, attention-deficit/hyperactivity disorder, autism spectrum disorders, Tourette's syndrome, conduct disorder/oppositional defiant disorder), and genetic syndromes (i.e., Fragile X syndrome, Prader-Willi syndrome, Williams syndrome, Angelman syndrome, and Rett syndrome). We also provide brief overviews of effective psychopharmacologic agents that have an effect on the dopamine system in these disorders. This review concludes with methodological considerations for future research designed to more clearly probe reward-circuitry dysfunction, with the ultimate goal of improved intervention strategies.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Spectrum Disorder (ASD), is a heterogeneous neurodevelopmental disorder with na estimated global prevalence rate of 17:10000, and a male to female ratio of 4:1. Patients with ASD presente language and communication difficulties and stereotyped behaviours. Comorbidity with other disorders, such as Intelectual Disability, Fragile-X syndrome (FXS) epilepsy and tuberous sclerosis frequently occurs. ASD presents amultifactorial etiopathology, and genetic factos alone are not suficiente to explain how the syndrome arises, with recente studies establishing ASD heritability at approximately 50%. Pre-, peri- and post-natal exposure to toxic environmental factos has been implicated in the development of ASD. Involvement of epigenetic regulatory mechanisms has been suggested, supported by the occurrence of autistic symptoms in patients with disorders aris ing from epigenetic mutations, such as FXS. A polygenic and epistatic model is a strong hypothesis to explain ASD. The main goal of this project is to identify specific exposure patterns to environmental toxicants in children diagnosed with ASD and integrate the results with genetic and epigenetic data.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Las enfermedades raras o huérfano son una problemática que ha tomado mucha importancia en el contexto mundial del presente siglo, estas se han definido como crónicas, de difícil tratamiento de sus síntomas y con baja prevalencia en la población; muchas de estas enfermedades cursan con varios tipos de discapacidad, siendo el objetivo del presente trabajo el enfocarse en aquellas enfermedades raras que cursan con discapacidad intelectual. Para poder profundizar en estas enfermedades se realizó una revisión teórica sobre las enfermedades raras, así como de la discapacidad psíquica y su importancia a nivel mundial y nacional. A partir de estas definiciones, se revisaron en profundidad 3 enfermedades raras que cursan con discapacidad intelectual en el contexto colombiano, como son: el síndrome de Rett, el síndrome de Prader-Willi y el síndrome de X frágil. En cada una de estas enfermedades además se explicaron los tipos de diagnóstico, intervención, prevención, grupos de apoyo y tipos de evaluación que más se usan en el contexto nacional

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Objective: To describe a new syndrome of X-linked myoclonic epilepsy with generalized spasticity and intellectual disability (XMESID) and identify the gene defect underlying this disorder. Methods: The authors studied a family in which six boys over two generations had intractable seizures using a validated seizure questionnaire, clinical examination, and EEG studies. Previous records and investigations were obtained. Information on seizure disorders was obtained on 271 members of the extended family. Molecular genetic analysis included linkage studies and mutational analysis using a positional candidate gene approach. Results: All six affected boys had myoclonic seizures and TCS; two had infantile spasms, but only one had hypsarrhythmia. EEG studies show diffuse background slowing with slow generalized spike wave activity. All affected boys had moderate to profound intellectual disability. Hyperreflexia was observed in obligate carrier women. A late-onset progressive spastic ataxia in the matriarch raises the possibility of late clinical manifestations in obligate carriers. The disorder was mapped to Xp11.2-22.2 with a maximum lod score of 1.8. As recently reported, a missense mutation (1058C>T/P353L) was identified within the homeodomain of the novel human Aristaless related homeobox gene (ARX). Conclusions: XMESID is a rare X-linked recessive myoclonic epilepsy with spasticity and intellectual disability in boys. Hyperreflexia is found in carrier women. XMESID is associated with a missense mutation in ARX. This disorder is allelic with X-linked infantile spasms (ISSX; MIM 308350) where polyalanine tract expansions are the commonly observed molecular defect. Mutations of ARX are associated with a wide range of phenotypes; functional studies in the future may lend insights to the neurobiology of myoclonic seizures and infantile spasms.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

90.00% 90.00%

Publicador:

Resumo:

BACKGROUND: Male carriers of the FMR1 premutation are at risk of developing the fragile X-associated tremor/ataxia syndrome (FXTAS), a newly recognised and largely under-diagnosed late onset neurodegenerative disorder. Patients affected with FXTAS primarily present with cerebellar ataxia and intention tremor. Cognitive decline has also been associated with the premutation, but the lack of data on its penetrance is a growing concern for clinicians who provide genetic counselling. METHODS: The Mattis Dementia Rating Scale (MDRS) was administered in a double blind fashion to 74 men aged 50 years or more recruited from fragile X families (35 premutation carriers and 39 intrafamilial controls) regardless of their clinical manifestation. Based on previous publications, marked cognitive impairment was defined by a score <or=123 on the MDRS. RESULTS: Both logistic and survival models confirmed that in addition to age and education level, premutation size plays a significant (p<0.01 and p<0.03 for logistic and survival model, respectively) role in cognitive impairment. The estimated penetrance of marked cognitive impairment in our sample (adjusted for the mean age 63.4 years and mean education level 9.7 years) for midsize/large (70-200 CGG) and small (55-69 CGG) premutation alleles was 33.3% (relative risk (RR) 6.5; p = 0.01) and 5.9% (RR 1.15; p = 0.9) respectively. Penetrance in the control group was 5.1%. CONCLUSIONS: Male carriers of midsize to large premutation alleles had a sixfold increased risk of developing cognitive decline and the risk increases with allele size. In addition, it was observed that cognitive impairment may precede motor symptoms. These data provide guidance for genetic counselling although larger samples are required to refine these estimates.