Variation between geographical populations of Lutzomyia (Nyssomyia) whitmani (Antunes & Coutinho, 1939) sensu lato (Diptera:Psychodidae:Phlebotominae) in Brazil

Phylogenetic analysis of morphometric and biological characters indicated that there are two distinct forms of Lutzomyia whitmani in Brazil: one is present both north and south of the River Amazonas in the State of Pará while the other occurs in northeast Brazil, in the State of Ceará, and further south, including the type locality in State of Bahia. The Amazonian form is reportedly neither strongly anthropophilic nor synanthropic, and it is the vector of Leishmania shawi; whereas the southern form is often collected peridomestically, while biting man, and has been found infected with Le.(V.) braziliensis. The ratio of the length of the genital filaments to that the genital pump was found to be consistently smaller in males of the Amazonian populations. A middle repetitive DNA element was isolated by differentially screening a genomic library made using Amazonian material, and the sequence was diagnostic for this form of Lu. whitmani (being absent or occurring in low copy number in the southern form). The total evidence suggests there are at least two, geographically-isolated forms of Lu. whitmani, which may represent different cryptic species.

Towards the Physical Map of the Trypanosoma cruzi Nuclear Genome: Construction of YAC and BAC Libraries of the Reference Clone T. cruzi CL-Brener

Strategies to construct the physical map of the Trypanosoma cruzi nuclear genome have to capitalize on three main advantages of the parasite genome, namely (a) its small size, (b) the fact that all chromosomes can be defined, and many of them can be isolated by pulse field gel electrophoresis, and (c) the fact that simple Southern blots of electrophoretic karyotypes can be used to map sequence tagged sites and expressed sequence tags to chromosomal bands. A major drawback to cope with is the complexity of T. cruzi genetics, that hinders the construction of a comprehensive genetic map. As a first step towards physical mapping, we report the construction and partial characterization of a T. cruzi CL-Brener genomic library in yeast artificial chromosomes (YACs) that consists of 2,770 individual YACs with a mean insert size of 365 kb encompassing around 10 genomic equivalents. Two libraries in bacterial artificial chromosomes (BACs) have been constructed, BACI and BACII. Both libraries represent about three genome equivalents. A third BAC library (BAC III) is being constructed. YACs and BACs are invaluable tools for physical mapping. More generally, they have to be considered as a common resource for research in Chagas disease

Determinació de la regió del genoma o gens implicats en la síntesi del polièster extracel•lular present en la variant llisa de Mycobacterium vaccae mitjançant transformació

Estudi realitzat a partir d’una estada a la Universidad de Zaragoza, Espanya, entre novembre del 2007 i abril del 2008. Mycobacterium vaccae és un micobacteri ambiental de creixement ràpid molt estudiat pel seu interès com a possible ús immunoterapéutic en el tractament de la tuberculosis i altres malalties. M.vaccae a l’igual que altres micobacteris presenta dues morfologies colonials: llisa i rugosa. M.vaccae ATCC15483T té originàriament una morfologia llisa. Quant aquest es cultiva en medi sòlid a 30ºC apareixen espontàniament variants rugoses estables que no reverteixen a llises. El motiu pel qual aquest procés té lloc no es coneix, encara que s’ha descrit en Mycobacterium smegmatis i en Mycobacterium avium que els lípids de la paret cel•lular es troben involucrats en aquest canvi de morfologia colonial. L’anàlisi dels contingut en lípids i glicolípids de la paret cel•lular de les dos variants morfològiques de M.vaccae, ens ha indicat que les soques llises presenten un compost extracel•lular que no es troba en les rugoses i que mitjançant l’anàlisi estructural d’aquest compost ha sigut identificat com un polièster extracel•lular de cadena llarga. El present estudi s’ha centrat en determinar els gens implicats en la síntesis d’aquest compost. Per a realitzar aquest anàlisi genètic s’ha construit una llibreria de mutants per transposició de la soca llisa de M. vaccae mitjançant un plàsmid ts/sac i un transposó. S’han obtingut colònies de morfologia rugosa on el plàsmid s’ha insertat en la zona del genoma que codifica per aquest compost extracel•lular. Aquests nous mutants s’han analitzat mitjançant tècniques moleculars (PCR, Southern y seqüenciació). A mès, s’ha construit una llibreria genòmica amb DNA de la soca llisa en plàsmids replicatius de micobacteris derivats de pAL5000 i s’ha transformat la soca rugosa seleccionant per a un fenotip llis estudiant els gens que complementen.

The future is genome-wide.

A report of the annual meeting of the European Society of Human Genetics, Amsterdam, 6-9 May 2006.

Novel acid phosphatase in Candida glabrata suggests selective pressure and niche specialization in the phosphate signal transduction pathway.

Evolution through natural selection suggests unnecessary genes are lost. We observed that the yeast Candida glabrata lost the gene encoding a phosphate-repressible acid phosphatase (PHO5) present in many yeasts including Saccharomyces cerevisiae. However, C. glabrata still had phosphate starvation-inducible phosphatase activity. Screening a C. glabrata genomic library, we identified CgPMU2, a member of a three-gene family that contains a phosphomutase-like domain. This small-scale gene duplication event could allow for sub- or neofunctionalization. On the basis of phylogenetic and biochemical characterizations, CgPMU2 has neofunctionalized to become a broad range, phosphate starvation-regulated acid phosphatase, which functionally replaces PHO5 in this pathogenic yeast. We determined that CgPmu2, unlike ScPho5, is not able to hydrolyze phytic acid (inositol hexakisphosphate). Phytic acid is present in fruits and seeds where S. cerevisiae grows, but is not abundant in mammalian tissues where C. glabrata grows. We demonstrated that C. glabrata is limited from an environment where phytic acid is the only source of phosphate. Our work suggests that during evolutionary time, the selection for the ancestral PHO5 was lost and that C. glabrata neofunctionalized a weak phosphatase to replace PHO5. Convergent evolution of a phosphate starvation-inducible acid phosphatase in C. glabrata relative to most yeast species provides an example of how small changes in signal transduction pathways can mediate genetic isolation and uncovers a potential speciation gene.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Molecular analysis of a novel gene cluster encoding an insect toxin in plant-associated strains of Pseudomonas fluorescens

Pseudomonas fluorescens CHA0 and the related strain Pf-5 are well-characterized representatives of rhizosphere bacteria that have the capacity to protect crop plants from fungal root diseases, mainly by releasing a variety of exoproducts that are toxic to plant pathogenic fungi. Here, we report that the two plant-beneficial pseudomonads also exhibit potent insecticidal activity. Anti-insect activity is linked to a novel genomic locus encoding a large protein toxin termed Fit (for P. fluorescensinsecticidal toxin) that is related to the insect toxin Mcf (Makes caterpillars floppy) of the entomopathogen Photorhabdus luminescens, a mutualist of insect-invading nematodes. When injected into the haemocoel, even low doses of P. fluorescens CHA0 or Pf-5 killed larvae of the tobacco hornworm Manduca sexta and the greater wax moth Galleria mellonella. In contrast, mutants of CHA0 or Pf-5 with deletions in the Fit toxin gene were significantly less virulent to the larvae. When expressed from an inducible promoter in a non-toxic Escherichia coli host, the Fit toxin gene was sufficient to render the bacterium toxic to both insect hosts. Our findings establish the Fit gene products of P. fluorescens CHA0 and Pf-5 as potent insect toxins that define previously unappreciated anti-insect properties of these plant-colonizing bacteria

Study of a region on yeast chromosome XIII that complements pet G199 mutants (COX7) and carries a new non-essential gene

The mutants of Saccharomyces cerevisiae assigned to complementation group G199 are deficient in mitochondrial respiration and lack a functional cytochrome oxidase complex. Recombinant plasmids capable of restoring respiration were cloned by transformation of mutants of this group with a yeast genomic library. Sequencing indicated that a 2.1-kb subclone encompasses the very end (last 11 amino acids) of the PET111 gene, the COX7 gene and a new gene (YMR255W) of unknown function that potentially codes for a polypeptide of 188 amino acids (about 21.5 kDa) without significant homology to any known protein. We have shown that the respiratory defect corresponding to group G199 is complemented by plasmids carrying only the COX7 gene. The gene YMR255W was inactivated by one-step gene replacement and the disrupted strain was viable and unaffected in its ability to grow in a variety of different test media such as minimal or complete media using eight distinct carbon sources at three pH values and temperatures. Inactivation of this gene also did not affect mating or sporulation

Overexpression of Salmonella enterica serovar Typhi recA gene confers fluoroquinolone resistance in Escherichia coli DH5α

A spontaneous fluoroquinolone-resistant mutant (STM1) was isolated from its parent Salmonella enterica serovar Typhi (S. Typhi) clinical isolate. Unlike its parent isolate, this mutant has selective resistance to fluoroquinolones without any change in its sensitivity to various other antibiotics. DNA gyrase assays revealed that the fluoroquinolone resistance phenotype of the STM1 mutant did not result from alteration of the fluoroquinolone sensitivity of the DNA gyrase isolated from it. To study the mechanism of fluoroquinolone resistance, a genomic library from the STM1 mutant was constructed in Escherichia coli DH5α and two recombinant plasmids were obtained. Only one of these plasmids (STM1-A) conferred the selective fluoroquinolone resistance phenotype to E. coli DH5α. The chromosomal insert from STM1-A, digested with EcoRI and HindIII restriction endonucleases, produced two DNA fragments and these were cloned separately into pUC19 thereby generating two new plasmids, STM1-A1 and STM1-A2. Only STM1-A1 conferred the selective fluoroquinolone resistance phenotype to E. coli DH5α. Sequence and subcloning analyses of STM1-A1 showed the presence of an intact RecA open reading frame. Unlike that of the wild-type E. coli DH5α, protein analysis of a crude STM1-A1 extract showed overexpression of a 40 kDa protein. Western blotting confirmed the 40 kDa protein band to be RecA. When a RecA PCR product was cloned into pGEM-T and introduced into E. coli DH5α, the STM1-A11 subclone retained fluoroquinolone resistance. These results suggest that overexpression of RecA causes selective fluoroquinolone resistance in E. coli DH5α.

Microsatellite primers for Ficus racemosa and Ficus rubiginosa

We developed 11 polymorphic microsatellite loci each for the figs Ficus (Sycomorus) racemosa and Ficus (Urostigma) rubiginosa from AG- and TG-enriched genomic libraries. These 22 loci were investigated for cross-species amplification and polymorphism in 17–21 F. racemosa and 16–24 F. rubiginosa individuals from Townsville, Australia. Observed heterozygosities range from 0.12 to 0.90 in F. racemosa and from 0.25 to 1.0 in F. rubiginosa.

A novel alpha-galactosidase from I'ifidobacterium bifidum with transgalactosylating properties: gene molecular cloning and heterologous expression

A genomic library of Bifidobacterium bifidum (NCIMB 41171) DNA was constructed in Escherichia coli RA11r (melA(-)B(+)) and one alpha-galactosidase encoding gene was isolated. Conceptual translation combined with insertional mutagenesis analysis indicated an open reading frame (ORF) of 759 amino acid (aa) residues encoding an alpha-galactosidase (named as MelA) of 82.8 kDa. Partial purification and characterisation showed that the enzyme had an apparent native molecular mass of a parts per thousand 243 kDa and a subunit size of a parts per thousand 85 kDa. The enzyme belongs to glycosyl hydrolases 36 family with high aa sequence similarities (a parts per thousand 73%) to other known alpha-galactosidases of bifidobacterial origin. Under optimum pH conditions for activity (pH 6.0) and high melibiose concentration (40% w/v), the enzyme was able to form oligosaccharides with degree of polymerisation (DP) a parts per thousand yen3 at higher concentration than DP = 2, with a total yield of 20.5% (w/w).

Tandem quadruplication of HMA4 in the zinc (Zn) and cadmium (Cd) hyperaccumulator Noccaea caerulescens

Zinc (Zn) and cadmium (Cd) hyperaccumulation may have evolved twice in the Brassicaceae, in Arabidopsis halleri and in the Noccaea genus. Tandem gene duplication and deregulated expression of the Zn transporter, HMA4, has previously been linked to Zn/Cd hyperaccumulation in A. halleri. Here, we tested the hypothesis that tandem duplication and deregulation of HMA4 expression also occurs in Noccaea. A Noccaea caerulescens genomic library was generated, containing 36,864 fosmid pCC1FOS (TM) clones with insert sizes similar to 20-40 kbp, and screened with a PCR-generated HMA4 genomic probe. Gene copy number within the genome was estimated through DNA fingerprinting and pooled fosmid pyrosequencing. Gene copy numbers within individual clones was determined by PCR analyses with novel locus specific primers. Entire fosmids were then sequenced individually and reads equivalent to 20-fold coverage were assembled to generate complete whole contigs. Four tandem HMA4 repeats were identified in a contiguous sequence of 101,480 bp based on sequence overlap identities. These were flanked by regions syntenous with up and downstream regions of AtHMA4 in Arabidopsis thaliana. Promoter-reporter beta-glucuronidase (GUS) fusion analysis of a NcHMA4 in A. thaliana revealed deregulated expression in roots and shoots, analogous to AhHMA4 promoters, but distinct from AtHMA4 expression which localised to the root vascular tissue. This remarkable consistency in tandem duplication and deregulated expression of metal transport genes between N. caerulescens and A. halleri, which last shared a common ancestor > 40 mya, provides intriguing evidence that parallel evolutionary pathways may underlie Zn/Cd hyperaccumulation in Brassicaceae.

Unusually short tandem repeats appear to reach chromosome ends of Rhynchosciara americana (Diptera: Sciaridae)

The characterisation of sequences at chromosome ends of Rhynchosciara americana was continued with the screening of a genomic library using as a probe a short repeat identified in a previous report (M-22, 22 bp) which was found to be specific for noncentromeric termini of this species. Simple repeats, complex tandem and apparently dispersed repeats were present in the genomic clones analysed. Repetitive sequences do not define individual chromosome tips as they were found in all noncentromeric ends. A novel and unusually short tandem repeat type for dipteran chromosome ends (named M-16) composed of 16 nucleotides and frequently associated with M-22 arrays was characterised in this work. Islands of M-16 and M-22 tandem repeats were found in all the genomic clones analysed. Individual probes representative of each repetitive element hybridised not only to all noncentromeric ends of R. americana chromosomes but also to inter-telomeric bridges. This contrasted with the other repeat types which displayed sub-telomeric localisation as seen by double detection of hybridised probe and telomeric reverse transcriptase. Some stretches composed of M-16 and M-22 tandem repeats localised in different regions of the analysed genomic clones were either identical or showed sequence similarity that was unexpectedly higher than the mean sequence similarity observed among repeats within each of their tandem arrays. The occurrence of segmental duplications, as deduced by sequence analyses involving the two repeats that appeared to reach chromosome ends, might indicate the involvement of this type of duplication process in the chromosome end maintenance in this species.