BREAKING UP OF MISFIT DISLOCATIONS IN GAASIN0.3GA0.7AS/GAAS HETEROSTRUCTURE

The effect of GaAs cap layer with different thicknesses in the GaAs/In0.3Ga0.7As/GaAs heterostructure on misfit dislocation is investigated with transmission electron microscopy, and it is found that lines of misfit dislocation break up and move out of the structure when the GaAs cap layer thickness exceeds a certain amount. The breaking up and moving out of misfit dislocations, initially confined in the (001) substrate/InGaAs epilayer interface, occur mainly along the [110] direction on the interface in the structure. (C) 1995 American Institute of Physics.

Dislocations in InAs epilayers grown by MBE on GaAs substrates under various conditions

Using Transmission Electron Microscopy, we studied the misfit and threading dislocations in InAs epilayers. All the samples, with thickness around 0.5 mu m, were grown on GaAs(001) substrates by molecular beam epitaxy under As-rich or in-rich conditions. The As-rich growth undergoes 2D-3D mode transition process, which was inhibited under In-rich surface. High step formation energy under As-deficient reconstruction inhibits the formation of 3D islands and leads to 2D growth. The mechanism of misfit dislocations formation was different under different growth condition which caused the variation of threading dislocation density in the epilayers.

Tight intermolecular packing through supramolecular interactions in crystals of cyano substituted oligo(para-phenylene vinylene): a key factor for aggregation-induced emission

Strong supramolecular interactions, which induced tight packing and rigid molecules in crystals of cyano substituent oligo(para-phenylene vinylene) (CN-DPDSB), are the key factor for the high luminescence efficiency of its crystals; opposite to its isolated molecules in solution which have very low luminescence efficiency.

Liquid crystalline phases, microtwinning in crystals and helical chirality transformations in a main-chain chiral liquid crystalline polyester

A main-chain nonracemic chiral liquid crystalline polymer was synthesized from (R)-(-)4'-{w-[2-(p-hydroxy-o-nitrophenyloxy)-1-propyloxy]-1-decyloxyl-4-biphenylcarboxylic acid. This polymer contained 10 methylene units in each chemical repeating unit and was abbreviated PET(R*-10). On the basis of differential scanning calorimetry, wide-angle X-ray diffraction, and polarized light microscopy experiments, chiral smectic C (S-C*) and chiral smectic A (S-A*) phases were identified. Both flat-elongated and helical lamellar crystal morphologies were observed in transmission electron microscopy. Of particular interest was the flat-elongated lamellar crystals were constructed via microtwinning of an orthorhombic cell with dimensions of a = 1.42 nm, b = 1.28 nm, and c = 3.04 nm. On the other hand, the helical lamellar crystals were exclusively left-handed, which was opposite to the right-handed helical crystals grown in PET(R*-9) and PET(R*-11) (having 9 and 11 methylene units, respectively). Note that these three polymers had identical right-handed chiral centers (R*-). Therefore, a single methylene unit difference on the polymer backbones on an atomic length scale substantially changed the chirality of the crystals in the micrometer length scale. Furthermore, aggregates of these helical crystals in PET(R*-10) did not generate banded spherulites in polarized light microscopy. Possible reasons for this change and loss of helical senses (handedness) on different length scales in chirality transferring processes were discussed.

Chemical bond properties of rare earth ions in crystals

By using the dielectric description theory of ionicity of solids, chemical bond properties of rare earth ions with various ligands are studied. Calculated results show that chemical bond properties of the same rare earth ion and the same ligand in different crystals depend on the crystal structures. In a series of compounds, chemical bond properties of crystals containing different rare earth ions are similar. The magnitude of covalency of chemical bonds of trivalent rare earth ions and various ligands has an order like F

Is the pinning of ordinary dislocations in γ-TiAl intrinsic or extrinsic in nature? A combined atomistic and kinetic Monte Carlo approach

We address the question of the observed pinning of 1/2

Stepwise self-assembly of a tripeptide from molecular dimers to supramolecular beta-sheets in crystals and amyloid-like fibrils in the solid state

The terminally protected tripeptide Boc-Ala(1)-Leu(2)-Ala(3)-OMe 1 forms antiparallel hydrogen-bonded dimers of two different conformers in the asymmetric unit and the individual dimers then self-associate to form supramolecular beta-sheet structures in crystals and amyloid-like fibrils in the solid state.

Supramolecular helix and beta-sheet through self-assembly of two isomeric tetrapeptides in crystals and formation of filaments and ribbons in the solid state

Single crystal X-ray diffraction studies show that the beta-turn structure of tetrapeptide I, Boc-Gly-Phe-Aib-Leu-OMe (Aib: alpha-amino isobutyric acid) self-assembles to a supramolecular helix through intermolecular hydrogen bonding along the crystallographic a axis. By contrast the beta-turn structure of an isomeric tetrapeptide II, Boc-Gly-Leu-Aib-Phe-OMe self-assembles to a supramolecular beta-sheet-like structure via a two-dimensional (a, b axis) intermolecular hydrogen bonding network and pi-pi interactions. FT-IR studies of the peptides revealed that both of them form intermolecularly hydrogen bonded supramolecular structures in the solid state. Field emission scanning electron micrographs (FE-SEM) of the dried fibrous materials of the peptides show different morphologies, non-twisted filaments in case of peptide I and non-twisted filaments and ribbon-like structures in case of peptide II.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Discourse-sensitive clitic-doubled dislocations in heritage Spanish

This experimental study tests the predictions of the Interface Hypothesis (Sorace, 2011, 2012) using two constructions whose appropriateness depends on monitoring discourse information: Clitic Left Dislocation and Fronted Focus. Clitic Left Dislocation relates a dislocated and clitic-doubled object to an antecedent activated in previous discourse, while Fronted Focus does not relate the fronted constituent to a discourse antecedent. The Interface Hypothesis argues that speakers in language contact situations experience difficulties when they have to integrate syntactic with discourse information. We tested four groups of native speakers on these constructions: Spanish monolinguals, bilinguals with more than 7 years residence in the US, intermediate and advanced proficiency heritage speakers. Our findings suggest that attrition has not set in the adult L2 bilingual speakers, and that the heritage speakers perform similarly to the monolingual and the adult sequential bilingual natives.

Photoinduced electronic transitions and leakage correlation to defects/dislocations in GaN heterostructures

III-nitride materials are very promising for high speed electronics/optical applications but still suffer in performance due to problems during high quality epitaxial growth, evolution of dislocation and defects, less understanding of fundamental physics of materials/processing of devices etc. This thesis mainly focus on GaN based heterostructures to understand the metal-semiconductor interface properties, 2DE(H)G influence on electrical and optical properties, and deep level states in GaN and InAlN, InGaN materials. The detailed electrical characterizations have been employed on Schottky diodes at GaN and InAl(Ga)N/GaN heterostructures in order to understand the metal-semiconductor interface related properties in these materials. I have observed the occurrence of Schottky barrier inhomogenity, role of dislocations in terms of leakage and creating electrically active defect states within energy gap of materials. Deep level transient spectroscopy method is employed on GaN, InAlN and InGaN materials and several defect levels have been observed related to majority and minority carriers. In fact, some defects have been found common in characteristics in ternary layers and GaN layer which indicates that those defect levels are from similar origin, most probably due to Ga/N vacancy in GaN/heterostructures. The role of structural defects, roughness has been extensively understood in terms of enhancing the reverse leakage current, suppressing the mobility in InAlN/AlN/GaN based high electron mobility transistor (HEMT) structures which are identified as key issues for GaN technology. Optical spectroscopy methods have been employed to understand materials quality, sub band and defect related transitions and compared with electrical characterizations. The observation of 2DEG sub band related absorption/emission in optical spectra have been identified and proposed for first time in nitride based polar heterostructures, which is well supported with simulation results. In addition, metal-semiconductor-metal (MSM)-InAl(Ga)N/GaN based photodetector structures have been fabricated and proposed for achieving high efficient optoelectronics devices in future.

Assessment of interatomic potentials for atomistic analysis of static and dynamic properties of screw dislocations in W

Screw dislocations in bcc metals display non-planar cores at zero temperature which result in high lattice friction and thermally-activated strain rate behavior. In bcc W, electronic structure molecular statics calculations reveal a compact, non-degenerate core with an associated Peierls stress between 1.7 and 2.8 GPa. However, a full picture of the dynamic behavior of dislocations can only be gained by using more efficient atomistic simulations based on semiempirical interatomic potentials. In this paper we assess the suitability of five different potentials in terms of static properties relevant to screw dislocations in pure W. Moreover, we perform molecular dynamics simulations of stress-assisted glide using all five potentials to study the dynamic behavior of screw dislocations under shear stress. Dislocations are seen to display thermally-activated motion in most of the applied stress range, with a gradual transition to a viscous damping regime at high stresses. We find that one potential predicts a core transformation from compact to dissociated at finite temperature that affects the energetics of kink-pair production and impacts the mechanism of motion. We conclude that a modified embedded-atom potential achieves the best compromise in terms of static and dynamic screw dislocation properties, although at an expense of about ten-fold compared to central potentials.