959 resultados para Detection process
Resumo:
The monitoring of infection control indicators including hospital-acquired infections is an established part of quality maintenance programmes in many health-care facilities. However, surveillance data use can be frustrated by the infrequent nature of many infections. Traditional methods of analysis often provide delayed identification of increasing infection occurrence, placing patients at preventable risk. The application of Shewhart, Cumulative Sum (CUSUM) and Exponentially Weighted Moving Average (EWMA) statistical process control charts to the monitoring of indicator infections allows continuous real-time assessment. The Shewhart chart will detect large changes, while CUSUM and EWMA methods are more suited to recognition of small to moderate sustained change. When used together, Shewhart and EWMA methods are ideal for monitoring bacteraemia and multiresistant organism rates. Shewhart and CUSUM charts are suitable for surgical infection surveillance.
Resumo:
Machine tool chatter is an unfavorable phenomenon during metal cutting, which results in heavy vibration of cutting tool. With increase in depth of cut, the cutting regime changes from chatter-free cutting to one with chatter. In this paper, we propose the use of permutation entropy (PE), a conceptually simple and computationally fast measurement to detect the onset of chatter from the time series using sound signal recorded with a unidirectional microphone. PE can efficiently distinguish the regular and complex nature of any signal and extract information about the dynamics of the process by indicating sudden change in its value. Under situations where the data sets are huge and there is no time for preprocessing and fine-tuning, PE can effectively detect dynamical changes of the system. This makes PE an ideal choice for online detection of chatter, which is not possible with other conventional nonlinear methods. In the present study, the variation of PE under two cutting conditions is analyzed. Abrupt variation in the value of PE with increase in depth of cut indicates the onset of chatter vibrations. The results are verified using frequency spectra of the signals and the nonlinear measure, normalized coarse-grained information rate (NCIR).
Resumo:
A sensitive and robust analytical method for spectrophotometric determination of ethyl xanthate, CH(3)CH(2)OCS(2)(-) at trace concentrations in pulp solutions from froth flotation process is proposed. The analytical method is based on the decomposition of ethyl xanthate. EtX(-), with 2.0 mol L(-1) HCl generating ethanol and carbon disulfide. CS(2). A gas diffusion cell assures that only the volatile compounds diffuse through a PTFE membrane towards an acceptor stream of deionized water, thus avoiding the interferences of non-volatile compounds and suspended particles. The CS(2) is selectively detected by UV absorbance at 206 nm (epsilon = 65,000 L mol(-1) cm(-1)). The measured absorbance is directly proportional to EtX(-) concentration present in the sample solutions. The Beer`s law is obeyed in a 1 x 10(-6) to 2 x 10(-4) mol L(-1) concentration range of ethyl xanthate in the pulp with an excellent correlation coefficient (r = 0.999) and a detection limit of 3.1 x 10(-7) mol L(-1), corresponding to 38 mu g L. At flow rates of 200 mu L min(-1) of the donor stream and 100 mu L min(-1) of the acceptor channel a sampling rate of 15 injections per hour could be achieved with RSD < 2.3% (n = 10, 300 mu L injections of 1 x 10(-5) mol L(-1) EtX(-)). Two practical applications demonstrate the versatility of the FIA method: (i) evaluation the free EtX(-) concentration during a laboratory study of the EtX(-) adsorption capacity on pulverized sulfide ore (pyrite) and (ii) monitoring of EtX(-) at different stages (from starting load to washing effluents) of a flotation pilot plant processing a Cu-Zn sulfide ore. (C) 2010 Elsevier By. All rights reserved.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Esse trabalho tem por objetivo o desenvolvimento de um sistema inteligente para detecção da queima no processo de retificação tangencial plana através da utilização de uma rede neural perceptron multi camadas, treinada para generalizar o processo e, conseqüentemente, obter o limiar de queima. em geral, a ocorrência da queima no processo de retificação pode ser detectada pelos parâmetros DPO e FKS. Porém esses parâmetros não são eficientes nas condições de usinagem usadas nesse trabalho. Os sinais de emissão acústica e potência elétrica do motor de acionamento do rebolo são variáveis de entrada e a variável de saída é a ocorrência da queima. No trabalho experimental, foram empregados um tipo de aço (ABNT 1045 temperado) e um tipo de rebolo denominado TARGA, modelo ART 3TG80.3 NVHB.
Resumo:
The ovary of the tick Ainblyomma triste is classified as panoistic, which is characterized by the presence of oogonia without nurse and follicular cells. The present study has demonstrated that the oocytes in all developmental stages (I-IV) are attached to the ovary through a pedicel, a cellular structure that synthesizes and provides carbohydrate, lipids and proteins supplies for the oocytes during the vitellogenesis process. The lipids are deposited during all oocyte stages; they are freely distributed as observed in stages II, III and IV or they form complexes with other elements. The proteins are also deposited in all stages of the oocytes, however, in lower concentration in the stage IV. There is carbohydrate deposition from oocytes in the stage II as well as in stages III and IV. In addition, the present work has demonstrated that the oocyte yolk of A. triste has a glycolipoprotein nature and the elements are deposited in the following sequence: firstly the lipids and proteins, and finally the carbohydrates. (c) 2007 Elsevier Ltd. All rights reserved.
Resumo:
This work aims the development of a dedicated system for detection of burning in surface grinding process, where the process will constantly be monitored through the acoustic emission and electric power of the induction motor drive. Acquired by an analog-digital converter, algorithms process the signals and a control signal is generated to inform the operator or interrupt the process in case of burning occurrence. Moreover, the system makes possible the process monitoring via Internet. Additionally, a comparative study between parameters DPO and FKS is carried through. In the experimental work one type of. steel (ABNT-1020 annealed) and one type of grinding wheel referred to as TARGA, model ART 3TG80.3 NVHB, were employed.
Resumo:
This work involved the development of a smart system dedicated to surface burning detection in the grinding process through constant monitoring of the process by acoustic emission and electrical power signals. A program in Visual Basic® for Windows® was developed, which collects the signals through an analog-digital converter and further processes them using burning detection algorithms already known. Three other parameters are proposed here and a comparative study carried out. When burning occurs, the newly developed software program sends a control signal warning the operator or interrupting the process, and delivers process information via the Internet. Parallel to this, the user can also interfere in the process via Internet, changing parameters and/or monitoring the grinding process. The findings of a comparative study of the various parameters are also discussed here. Copyright © 2006 by ABCM.
Resumo:
In this paper we discuss the detection of glucose and triglycerides using information visualization methods to process impedance spectroscopy data. The sensing units contained either lipase or glucose oxidase immobilized in layer-by-layer (LbL) films deposited onto interdigitated electrodes. The optimization consisted in identifying which part of the electrical response and combination of sensing units yielded the best distinguishing ability. It is shown that complete separation can be obtained for a range of concentrations of glucose and triglyceride when the interactive document map (IDMAP) technique is used to project the data into a two-dimensional plot. Most importantly, the optimization procedure can be extended to other types of biosensors, thus increasing the versatility of analysis provided by tailored molecular architectures exploited with various detection principles. (C) 2012 Elsevier B.V. All rights reserved.
Resumo:
2000 Mathematics Subject Classification: Primary 60G70, 62F03.
Resumo:
Given the growing number of wrongful convictions involving faulty eyewitness evidence and the strong reliance by jurors on eyewitness testimony, researchers have sought to develop safeguards to decrease erroneous identifications. While decades of eyewitness research have led to numerous recommendations for the collection of eyewitness evidence, less is known regarding the psychological processes that govern identification responses. The purpose of the current research was to expand the theoretical knowledge of eyewitness identification decisions by exploring two separate memory theories: signal detection theory and dual-process theory. This was accomplished by examining both system and estimator variables in the context of a novel lineup recognition paradigm. Both theories were also examined in conjunction with confidence to determine whether it might add significantly to the understanding of eyewitness memory. ^ In two separate experiments, both an encoding and a retrieval-based manipulation were chosen to examine the application of theory to eyewitness identification decisions. Dual-process estimates were measured through the use of remember-know judgments (Gardiner & Richardson-Klavehn, 2000). In Experiment 1, the effects of divided attention and lineup presentation format (simultaneous vs. sequential) were examined. In Experiment 2, perceptual distance and lineup response deadline were examined. Overall, the results indicated that discrimination and remember judgments (recollection) were generally affected by variations in encoding quality and response criterion and know judgments (familiarity) were generally affected by variations in retrieval options. Specifically, as encoding quality improved, discrimination ability and judgments of recollection increased; and as the retrieval task became more difficult there was a shift toward lenient choosing and more reliance on familiarity. ^ The application of signal detection theory and dual-process theory in the current experiments produced predictable results on both system and estimator variables. These theories were also compared to measures of general confidence, calibration, and diagnosticity. The application of the additional confidence measures in conjunction with signal detection theory and dual-process theory gave a more in-depth explanation than either theory alone. Therefore, the general conclusion is that eyewitness identifications can be understood in a more complete manor by applying theory and examining confidence. Future directions and policy implications are discussed. ^
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.
Resumo:
Enzyme production is a growing field in biotechnology and increasing attention has been devoted to the solid-state fermentation (SSF) of lignocellulosic biomass for production of industrially relevant lignocellulose deconstruction enzymes, especially manganese-peroxidase (MnP), which plays a crucial role in lignin degradation. However, there is a scarcity of studies regarding extraction of the secreted metabolities that are commonly bound to the fermented solids, preventing their accurate detection and limiting recovery efficiency. In the present work, we assessed the effectiveness of extraction process variables (pH, stirring rate, temperature, and extraction time) on recovery efficiency of manganese-peroxidase (MnP) obtained by SSF of eucalyptus residues using Lentinula edodes using statistical design of experiments. The results from this study indicated that of the variables studied, pH was the most significant (p < 0.05%) parameter affecting MnP recovery yield, while temperature, extraction time, and stirring rate presented no statistically significant effects in the studied range. The optimum pH for extraction of MnP was at 4.0-5.0, which yielded 1500-1700 IU kg (1) of enzyme activity at extraction time 4-5 h, under static condition at room temperature. (C) 2011 Elsevier Ltd. All rights reserved.