988 resultados para Concrete Defect Detection


Relevância:

30.00% 30.00%

Publicador:

Resumo:

The behaviour of the interface between the FRP and the concrete is the key factor controlling debonding failures in FRP-strengthened RC structures. This defect can cause reductions in static strength, structural integrity and the change in the dynamic behavior of the structure. The adverse effect on the dynamic behavior of the defects can be utilized as an effective means for identifying and assessing both the location and size of debonding at its earliest stages. The presence of debonding changes the structural dynamic characteristics and might be traced in modal parameters, dynamic strain and wave patterns etc. Detection of minor local defects, as those origin of a future debonding, requires working at high frequencies so that the wavelength of the excited is small and sensitive enough to detect local damage. The development of a spectral element method gives a large potential in high-frequency structural modeling. In contrast to the conventional finite element, since inertial properties are modeled exactly few elements are necessary to capture very accurate solutions at the highest frequencies in large regions. A wide variety of spectral elements have been developed for structural members over finite and semi-infinite regions. The objective of this paper is to develop a Spectral Finite Element Model to efficiently capture the behavior of intermediate debonding of a FRP strengthened RC beam during wave-based diagnostics.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Esta Tesis tiene como objetivo principal el desarrollo de métodos de identificación del daño que sean robustos y fiables, enfocados a sistemas estructurales experimentales, fundamentalmente a las estructuras de hormigón armado reforzadas externamente con bandas fibras de polímeros reforzados (FRP). El modo de fallo de este tipo de sistema estructural es crítico, pues generalmente es debido a un despegue repentino y frágil de la banda del refuerzo FRP originado en grietas intermedias causadas por la flexión. La detección de este despegue en su fase inicial es fundamental para prevenir fallos futuros, que pueden ser catastróficos. Inicialmente, se lleva a cabo una revisión del método de la Impedancia Electro-Mecánica (EMI), de cara a exponer sus capacidades para la detección de daño. Una vez la tecnología apropiada es seleccionada, lo que incluye un analizador de impedancias así como novedosos sensores PZT para monitorización inteligente, se ha diseñado un procedimiento automático basado en los registros de impedancias de distintas estructuras de laboratorio. Basándonos en el hecho de que las mediciones de impedancias son posibles gracias a una colocación adecuada de una red de sensores PZT, la estimación de la presencia de daño se realiza analizando los resultados de distintos indicadores de daño obtenidos de la literatura. Para que este proceso sea automático y que no sean necesarios conocimientos previos sobre el método EMI para realizar un experimento, se ha diseñado e implementado un Interfaz Gráfico de Usuario, transformando la medición de impedancias en un proceso fácil e intuitivo. Se evalúa entonces el daño a través de los correspondientes índices de daño, intentando estimar no sólo su severidad, sino también su localización aproximada. El desarrollo de estos experimentos en cualquier estructura genera grandes cantidades de datos que han de ser procesados, y algunas veces los índices de daño no son suficientes para una evaluación completa de la integridad de una estructura. En la mayoría de los casos se pueden encontrar patrones de daño en los datos, pero no se tiene información a priori del estado de la estructura. En este punto, se ha hecho una importante investigación en técnicas de reconocimiento de patrones particularmente en aprendizaje no supervisado, encontrando aplicaciones interesantes en el campo de la medicina. De ahí surge una idea creativa e innovadora: detectar y seguir la evolución del daño en distintas estructuras como si se tratase de un cáncer propagándose por el cuerpo humano. En ese sentido, las lecturas de impedancias se emplean como información intrínseca de la salud de la propia estructura, de forma que se pueden aplicar las mismas técnicas que las empleadas en la investigación del cáncer. En este caso, se ha aplicado un algoritmo de clasificación jerárquica dado que ilustra además la clasificación de los datos de forma gráfica, incluyendo información cualitativa y cuantitativa sobre el daño. Se ha investigado la efectividad de este procedimiento a través de tres estructuras de laboratorio, como son una viga de aluminio, una unión atornillada de aluminio y un bloque de hormigón reforzado con FRP. La primera ayuda a mostrar la efectividad del método en sencillos escenarios de daño simple y múltiple, de forma que las conclusiones extraídas se aplican sobre los otros dos, diseñados para simular condiciones de despegue en distintas estructuras. Demostrada la efectividad del método de clasificación jerárquica de lecturas de impedancias, se aplica el procedimiento sobre las estructuras de hormigón armado reforzadas con bandas de FRP objeto de esta tesis, detectando y clasificando cada estado de daño. Finalmente, y como alternativa al anterior procedimiento, se propone un método para la monitorización continua de la interfase FRP-Hormigón, a través de una red de sensores FBG permanentemente instalados en dicha interfase. De esta forma, se obtienen medidas de deformación de la interfase en condiciones de carga continua, para ser implementadas en un modelo de optimización multiobjetivo, cuya solución se haya por medio de una expansión multiobjetivo del método Particle Swarm Optimization (PSO). La fiabilidad de este último método de detección se investiga a través de sendos ejemplos tanto numéricos como experimentales. ABSTRACT This thesis aims to develop robust and reliable damage identification methods focused on experimental structural systems, in particular Reinforced Concrete (RC) structures externally strengthened with Fiber Reinforced Polymers (FRP) strips. The failure mode of this type of structural system is critical, since it is usually due to sudden and brittle debonding of the FRP reinforcement originating from intermediate flexural cracks. Detection of the debonding in its initial stage is essential thus to prevent future failure, which might be catastrophic. Initially, a revision of the Electro-Mechanical Impedance (EMI) method is carried out, in order to expose its capabilities for local damage detection. Once the appropriate technology is selected, which includes impedance analyzer as well as novel PZT sensors for smart monitoring, an automated procedure has been design based on the impedance signatures of several lab-scale structures. On the basis that capturing impedance measurements is possible thanks to an adequately deployed PZT sensor network, the estimation of damage presence is done by analyzing the results of different damage indices obtained from the literature. In order to make this process automatic so that it is not necessary a priori knowledge of the EMI method to carry out an experimental test, a Graphical User Interface has been designed, turning the impedance measurements into an easy and intuitive procedure. Damage is then assessed through the analysis of the corresponding damage indices, trying to estimate not only the damage severity, but also its approximate location. The development of these tests on any kind of structure generates large amounts of data to be processed, and sometimes the information provided by damage indices is not enough to achieve a complete analysis of the structural health condition. In most of the cases, some damage patterns can be found in the data, but none a priori knowledge of the health condition is given for any structure. At this point, an important research on pattern recognition techniques has been carried out, particularly on unsupervised learning techniques, finding interesting applications in the medicine field. From this investigation, a creative and innovative idea arose: to detect and track the evolution of damage in different structures, as if it were a cancer propagating through a human body. In that sense, the impedance signatures are used to give intrinsic information of the health condition of the structure, so that the same clustering algorithms applied in the cancer research can be applied to the problem addressed in this dissertation. Hierarchical clustering is then applied since it also provides a graphical display of the clustered data, including quantitative and qualitative information about damage. The performance of this approach is firstly investigated using three lab-scale structures, such as a simple aluminium beam, a bolt-jointed aluminium beam and an FRP-strengthened concrete specimen. The first one shows the performance of the method on simple single and multiple damage scenarios, so that the first conclusions can be extracted and applied to the other two experimental tests, which are designed to simulate a debonding condition on different structures. Once the performance of the impedance-based hierarchical clustering method is proven to be successful, it is then applied to the structural system studied in this dissertation, the RC structures externally strengthened with FRP strips, where the debonding failure in the interface between the FRP and the concrete is successfully detected and classified, proving thus the feasibility of this method. Finally, as an alternative to the previous approach, a continuous monitoring procedure of the FRP-Concrete interface is proposed, based on an FBGsensors Network permanently deployed within that interface. In this way, strain measurements can be obtained under controlled loading conditions, and then they are used in order to implement a multi-objective model updating method solved by a multi-objective expansion of the Particle Swarm Optimization (PSO) method. The feasibility of this last proposal is investigated and successfully proven on both numerical and experimental RC beams strengthened with FRP.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Outliers are objects that show abnormal behavior with respect to their context or that have unexpected values in some of their parameters. In decision-making processes, information quality is of the utmost importance. In specific applications, an outlying data element may represent an important deviation in a production process or a damaged sensor. Therefore, the ability to detect these elements could make the difference between making a correct and an incorrect decision. This task is complicated by the large sizes of typical databases. Due to their importance in search processes in large volumes of data, researchers pay special attention to the development of efficient outlier detection techniques. This article presents a computationally efficient algorithm for the detection of outliers in large volumes of information. This proposal is based on an extension of the mathematical framework upon which the basic theory of detection of outliers, founded on Rough Set Theory, has been constructed. From this starting point, current problems are analyzed; a detection method is proposed, along with a computational algorithm that allows the performance of outlier detection tasks with an almost-linear complexity. To illustrate its viability, the results of the application of the outlier-detection algorithm to the concrete example of a large database are presented.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

National Highway Traffic Safety Administration, Office of Research and Development, Washington, D.C.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This thesis considers two basic aspects of impact damage in composite materials, namely damage severity discrimination and impact damage location by using Acoustic Emissions (AE) and Artificial Neural Networks (ANNs). The experimental work embodies a study of such factors as the application of AE as Non-destructive Damage Testing (NDT), and the evaluation of ANNs modelling. ANNs, however, played an important role in modelling implementation. In the first aspect of the study, different impact energies were used to produce different level of damage in two composite materials (T300/914 and T800/5245). The impacts were detected by their acoustic emissions (AE). The AE waveform signals were analysed and modelled using a Back Propagation (BP) neural network model. The Mean Square Error (MSE) from the output was then used as a damage indicator in the damage severity discrimination study. To evaluate the ANN model, a comparison was made of the correlation coefficients of different parameters, such as MSE, AE energy, AE counts, etc. MSE produced an outstanding result based on the best performance of correlation. In the second aspect, a new artificial neural network model was developed to provide impact damage location on a quasi-isotropic composite panel. It was successfully trained to locate impact sites by correlating the relationship between arriving time differences of AE signals at transducers located on the panel and the impact site coordinates. The performance of the ANN model, which was evaluated by calculating the distance deviation between model output and real location coordinates, supports the application of ANN as an impact damage location identifier. In the study, the accuracy of location prediction decreased when approaching the central area of the panel. Further investigation indicated that this is due to the small arrival time differences, which defect the performance of ANN prediction. This research suggested increasing the number of processing neurons in the ANNs as a practical solution.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Catastrophic failure from intentional terrorist attacks on surface transportation infrastructure could he detrimental to the society. In order to minimize the vulnerabilities and to ensure a safe transportation system, the issue of security for transportation structures, primarily bridges, which are subjected to man-made hazards is investigated in this study. A procedure for identifying and prioritizing "critical bridges" using a screening and prioritization processes is established. For each of the "critical" bridges, a systematic risk-based assessment approach is proposed that takes into account the combination of threat occurrence likelihood, its consequences, and the socioeconomic importance of the bridge. A series of effective security countermeasures are compiled in the four categories of deterrence, detection, defense and mitigation to help reduce the vulnerability of critical bridges. The concepts of simplified equivalent I-shape cross section and virtual materials are proposed for integration into a nonlinear finite element model, which helps assess the performance of reinforced concrete structures with and without composite retrofit or hardening measures under blast loading. A series of parametric studies are conducted for single column and two-column pier frame systems as well as for an entire bridge. The parameters considered include column height, column type, concrete strength, longitudinal steel reinforcement ratio, thickness, fiber angle and tensile strength of the fiber reinforced polymer (FRP) tube, shape of the cross section, damping ratio and different bomb sizes. The study shows the benefits of hardening with composites against blast loading. The effect of steel reinforcement on blast resistance of the structure is more significant than the effect of concrete compressive strength. Moreover, multiple blasts do not necessarily lead to a more severe destruction than a single detonation at a strategically vulnerable location on the bridges.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Portland cement concrete (PCC) pavement undergoes repeated environmental load-related deflection resulting from temperature and moisture variations across the pavement depth. This phenomenon, referred to as PCC pavement curling and warping, has been known and studied since the mid-1920s. Slab curvature can be further magnified under repeated traffic loads and may ultimately lead to fatigue failures, including top-down and bottom-up transverse, longitudinal, and corner cracking. It is therefore important to measure the “true” degree of curling and warping in PCC pavements, not only for quality control (QC) and quality assurance (QA) purposes, but also to achieve a better understanding of its relationship to long-term pavement performance. In order to better understand the curling and warping behavior of PCC pavements in Iowa and provide recommendations to mitigate curling and warping deflections, field investigations were performed at six existing sites during the late fall of 2015. These sites included PCC pavements with various ages, slab shapes, mix design aspects, and environmental conditions during construction. A stationary light detection and ranging (LiDAR) device was used to scan the slab surfaces. The degree of curling and warping along the longitudinal, transverse, and diagonal directions was calculated for the selected slabs based on the point clouds acquired using LiDAR. The results and findings are correlated to variations in pavement performance, mix design, pavement design, and construction details at each site. Recommendations regarding how to minimize curling and warping are provided based on a literature review and this field study. Some examples of using point cloud data to build three-dimensional (3D) models of the overall curvature of the slab shape are presented to show the feasibility of using this 3D analysis method for curling and warping analysis.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The thesis explores recent technology developments in the field of structural health monitoring and its application to railway bridge projects. It focuses on two main topics. First, service loads and effect of environmental actions are modelled. In particular, the train moving load and its interaction with rail track is considered with different degrees of detail. Hence, results are compared with real-time experimental measurements. Secondly, the work concerns the identification, definition and modelling process of damages for a prestressed concrete railway bridge, and their implementation inside FEM models. Along with a critical interpretation of the in-field measurements, this approach results in the development of undamaged and damaged databases for the AI-aided detection of anomalies and the definition of threshold levels to prompt automatic alert interventions. In conclusion, an innovative solution for the development of the railway weight-in-motion system is proposed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

An unusual presentation of a focal osteoporotic bone marrow defect (FOBMD) of the mandible mimicking a cystic lesion is documented. A definitive diagnosis could be established only on the basis of the histopathologic evaluation. A 66-year-old Brazilian woman was referred by her dentist for well-defined radiolucency of the mandibular molar region suggesting a cystic lesion of odontogenic origin. The computed tomography scan confirmed that the lesion did not affect the corticals. The biopsy confirmed the diagnosis of FOBMD. The diagnostic difficulty in the current case is obvious, because FOBMD, usually exhibiting an ill-defined radiolucency, is seldom suspected preoperatively when a differential diagnosis is considered for focal well-defined radiolucent areas in the jaws.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.