703 resultados para Limiar de percolação


Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this study was to define a method for estimating soybean crop area in the Northern Rio Grande do Sul state (Brazil). Overall, six different remote sensing methods were proposed based on spectral-temporal profile and minimum and maximum values of NDVI/MODIS related to the stages of sowing, maximum development and harvesting of soybean areas. The resulting estimates were compared to official crop area data provided by the Brazilian government, using statistical analysis and the fuzzy similarity method. The performance of each method depended on information such as crop size, type of crop management, and sowing/harvesting dates. Regression coefficients of determination and fuzzy agreement values were above 0.8 and 0.45, respectively, for all methods. For operational monitoring of soybean crop area, the empirical threshold applied to the image difference with inclusion of harvest image method was the most effective, producing estimates that matched closely the official data. For spatial analysis the application of multitemporal images classification method is recommended that generated a map of better quality. The efficiency of these methods should be evaluated in the areas of soybean expansion in the state.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

INTRODUÇÃO:Testes incrementais de corrida permitem a determinação de limiares metabólicos e neuromusculares. O objetivo do presente estudo foi comparar índices eletromiográficos e metabólicos entre dois protocolos incrementais de corrida com diferentes intervalos entre cada estágio de velocidade.MÉTODOS:Participaram do estudo 14 voluntários do sexo masculino. Os protocolos incrementais de corrida em esteira iniciaram em 8 km.h-1, com incremento de 1 km.h-1 a cada três minutos até a exaustão voluntária. Os dois protocolos diferiram quanto aos intervalos entre cada estágio de velocidade: 30 segundos (protocolo 1) e 120 segundos (protocolo 2). O limiar de fadiga eletromiográfico (LFEMG) foi determinado para os músculos reto femoral, bíceps femoral, tibial anterior e gastrocnêmio lateral. Para tanto, o comportamento do valor RMS foi correlacionado em função do tempo de corrida, sendo realizada regressão linear para determinação dos coeficientes de inclinação. O limiar de lactato foi identificado por meio do ponto de inflexão na curva lactato-intensidade e o limiar anaeróbio foi determinado por meio de interpolação linear. Foi aplicado um teste t de Student para dados pareados (p<0,05).RESULTADOS:Foi verificado que o protocolo 2 apresentou velocidade de LFEMG maior do que o protocolo 1, apenas para o músculo BF (p=0,023), o que caracteriza uma resposta específica deste músculo em protocolos incrementais de corrida.CONCLUSÃO:Protocolos de corrida com intervalos de até dois minutos entre os estágios incrementais apresentaram resultados semelhantes para determinação do LFEMG da maioria dos músculos estudados e dos limiares metabólicos.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

INTRODUÇÃO: A determinação dos domínios de intensidade de exercício tem importantes implicações na prescrição do treino aeróbio e na elaboração de delineamentos experimentais. OBJETIVO: Analisar os efeitos do nível de aptidão aeróbia sobre a amplitude dos domínios de intensidade de exercício durante o ciclismo. MÉTODOS: Doze ciclistas (CIC), 11 corredores (COR) e oito indivíduos não treinados (NT) foram submetidos aos seguintes protocolos em diferentes dias: 1) teste progressivo para determinação do limiar de lactato (LL), consumo máximo de oxigênio (VO2máx) e sua respectiva intensidade (IVO2máx); 2) três testes de carga constante até a exaustão a 95, 100 e 110% IVO2máx para a determinação da potência crítica (PC); 3) testes até a exaustão para determinar a intensidade superior do domínio severo (Isup). As amplitudes dos domínios (moderado < LL; LL > pesado < PC; PC > severo < Isup) foram expressas como percentual da Isup (VO2). RESULTADOS: A amplitude do domínio moderado foi similar entre CIC (52 ± 8%) e COR (47 ± 4%) e significantemente maior no CIC em relação ao NT (41 ± 7%). O domínio pesado foi significantemente menor no CIC (17 ± 6%) em relação ao COR (27 ± 6%) e NT (27 ± 9%). Em relação ao domínio severo não foram encontradas diferenças significantes entre os CIC (31 ± 7%), COR (26 ± 5%) e NT (31 ± 7%). CONCLUSÃO: O domínio pesado de exercício é mais sensível a mudanças determinadas pelo nível de aptidão aeróbia, existindo a necessidade de que se atenda ao princípio da especificidade do movimento, quando se pretende obter um elevado grau de adaptação fisiológica.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pós-graduação em Genética e Melhoramento Animal - FCAV

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pós-graduação em Agronomia (Irrigação e Drenagem) - FCA

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The aim of this study was to investigate the effects of three weeks of training with intensity monitored on the aerobic capacity of professional soccer players. Fourteen players, members of a first division Brazilian Championship team in 2010, aged 22.78 +/- 3.06 years were evaluated pre and post three weeks of training. The anaerobic threshold intensity LAn was determined by bi-segmented method, for this four submaximal efforts of 800 meters with intensities 10, 12, 14 and 16 km/h were applied. Thirty three training sessions were quantified in zones according to heart rate related to the LAn (FCLAn): Z1 - 10% below, Z2 - 90-100% and Z3 - above the FCLAn. During training participants remained 31.17 +/- 14.86%, 42.96% and 25.87 +/- 14.90 +/- 16.67% in Z1, Z2, and Z3 respectively. There were no significant differences in the LAn (pre = 13,29 +/- 0,71 km.h(-1); post = 12,85 +/- 0,90 km.h(-1)), perceived exertion (pre = 11,53 +/- 1,45 u.a; post = 11,23 +/- 1,53 u.a) and FCLAn (pre = 166,64 +/- 10,69 bpm; post = 174,50 +/- 10,89 bpm) between conditions before and after training, indicating that three weeks of training are insufficient to generate positive changes in soccer players LAn.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The purpose of the study was to examine the relationships between intermittent high-intensity efforts (RAST) parameters and variables related to aerobic metabolism (anaerobic threshold; LAN, maximal oxygen uptake; VO2MAX and velocity correspondent to VO2MAX; iVO(2MAX)). Eight under-17 (U17) soccer players (16 +/- 1 years) participated in the study. The participants were submitted to a graded exercise test and six maximal sprints of 35m with 10 seconds of passive recovery between each effort (RAST). The RAST parameters were not significant correlated with VO2MAX and LAN. However absolute and relative mean power were significantly correlated with iVO(2MAX) (r=0.79 e r=0.85, respectively). Furthermore, the fatigue index and the relative peak power were significantly correlated with the iVO(2MAX) (r=-0,57 e r=0,73, respectively). In conclusion, the only aerobic variable correlated with performance in consecutive efforts with brief recovery periods, such as RAST, is iVO(2MAX).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pós-graduação em História - FCLAS