Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

46,XX Male - Testicular Disorder of Sexual Differentiation (DSD): hormonal, molecular and cytogenetic studies

The XX male syndrome - Testicular Disorder of Sexual Differentiation (DSD) is a rare condition characterized by a spectrum of clinical presentations, ranging from ambiguous to normal male genitalia. We report hormonal, molecular and cytogenetic evaluations of a boy presenting with this syndrome. Examination of the genitalia at age of 16 months, showed: penis of 3.5 cm, proximal hypospadia and scrotal testes. Pelvic ultrasound did not demonstrate Mullerian duct structures. Karyotype was 46,XX. Gonadotrophin stimulation test yielded insufficient testosterone production. Gonadal biopsy showed seminiferous tubules without evidence of Leydig cells. Molecular studies revealed that SRY and TSPY genes and also DYZ3 sequences were absent. In addition, the lack of deletions or duplications of SOX9, NR5A1, WNT4 and NROB1 regions was verified. The infant was heterozygous for all microsatellites at the 9p region, including DMRT1 gene, investigated. Only 10% of the patients are SRY-negative and usually they have ambiguous genitalia, as the aforementioned patient. The incomplete masculinization suggests gain of function mutation in one or more genes downstream to SRY gene.

Long-term follow-up of an 8-year-old boy with insulinoma as the first manifestation of a familial form of multiple endocrine neoplasia type 1

Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant hereditary cancer syndrome characterized mostly by parathyroid, enteropancreatic, and anterior pituitary tumors. We present a case of an 8-year-old boy referred because of hypoglycemic attacks. His diagnosis was pancreatic insulinoma. Paternal grandmother died due to repeated gastroduodenal ulcerations and a paternal aunt presented similar manifestations. At a first evaluation, the father presented only gastric ulceration but subsequently developed hyperparathyroidism and lung carcinoid tumor. During almost 15 years of follow-up, three brothers and the index case presented hyperparathyroidism and hyperprolactinemia. Molecular study showed a G to A substitution in intron 4, at nine nucleotides upstream of the splicing acceptor site, causing a splicing mutation. All affected members of the family have the same mutation. Paternal grandmother and aunt were not studied and the mother does not carry any mutation. MEN1 is a rare condition that requires permanent medical assistance. Early clinical and genetic identification of affected individuals is essential for their own surveillance and also for genetic counseling.

The use of fluorescence in situ hybridization in the diagnosis of hidden mosaicism: apropos of three cases of sex chromosome anomalies

FISH has been used as a complement to classical cytogenetics in the detection of mosaicism in sex chromosome anomalies. The aim of this study is to describe three cases in which the final diagnosis could only be achieved by FISH. Case 1 was an 8-year-old 46,XY girl with normal female genitalia referred to our service because of short stature. FISH analysis of lymphocytes with probes for the X and Y centromeres identified a 45,X/46,X,idic(Y) constitution, and established the diagnosis of Turner syndrome. Case 2 was a 21-month-old 46,XY boy with genital ambiguity (penile hypospadias, right testis, and left streak gonad). FISH analysis of lymphocytes and buccal smear identified a 45,X/46,XY karyotype, leading to diagnosis of mixed gonadal dysgenesis. Case 3 was a 47,XYY 19-year-old boy with delayed neuromotor development, learning disabilities, psychological problems, tall stature, small testes, elevated gonadotropins, and azoospermia. FISH analysis of lymphocytes and buccal smear identified a 47,XYY/48,XXYY constitution. Cases 1 and 2 illustrate the phenotypic variability of the 45,X/46,XY mosaicism, and the importance of detection of the 45,X cell line for proper management and follow-up. In case 3, abnormal gonadal function could be explained by the 48,XXYY cell line. The use of FISH in clinical practice is particularly relevant when classical cytogenetic analysis yields normal or uncertain results in patients with features of sex chromosome aneuploidy. Arq Bras Endocrinol Metab. 2012;56(8):545-51

Paracoccidioidomicose primária de pálpebra e conjuntiva

Paracoccidioidomycosis is the most frequent systemic mycosis in Brazil, but ocular involvement is rare and, if present, often secondary to another site. The authors report a case of paracoccidioidomycosis of eyelid and conjunctiva where no extraocular focus was found. A brief review of the literature is made discussing the importance of diagnostic suspecion in a population at risk and early treatment for a good visual prognosis.

Esclerite infecciosa espontânea por Nocardia asteroides: relato de caso

PURPOSE: To report a case of Nocardia asteroides scleritis in a patient without risk factors for infeccious scleritis. METHODS: A 38-year old woman was initially examined for pain, discharge, photophobia of 1 month duration in her right eye. Her medical and ophthalmological history were unremarkable. The results of laboratory tests were normal. Surgical debridement of necrotic tissue was performed and material was sent for biopsy and culture confirmed as Nocardia asteroides. Treatment consisted of amikacin eyedrops, and systemic trimethropim-sulfamethoxazole. The infection resolved leaving scleral thinning and a subconjunctival fibrovascular scar. Best corrected visual acuity two months after referral had improved to LE, 20/20. CONCLUSION: Prompt evaluation and treatment is essential for successful management of Nocardia asteroides infectious scleritis.

Ocular masquerade syndrome associated with extranodal nasal natural killer/T-cell lymphoma: case report

A 33-year-old woman complained of unilateral eyelid edema and blurred vision. Initial ophthalmic examination disclosed anterior chamber reaction with keratic precipitates on the cornea, without posterior abnormalities. Anterior uveitis was treated. Despite that, patient showed rapidly progressive unilateral vision loss with optic nerve swelling. Systemic workup was inconclusive, as well as cranial magnetic resonance imaging and cerebrospinal fluid examination. Based on the hypothesis of optic neuritis, intravenous methylprednisolone pulse was performed with no success. During the following days, the patient presented pericardial effusion and cardiac tamponade, progressing to death. Necropsy was performed and diagnosis of extranodal natural killers/T-cell lymphoma, nasal type with ocular involvement was confirmed by immunohistochemistry.

Nossa notação m' na prova de Rorschach: ampliação e restrição do fator m de Klopfer

Klopfer's differentiation of movement scores, among which inanimate movement integrating the minor movements group, was no doubt opportune and needed. Their peculiar meaning has been clearly stressed and enriched by Piotrowski in his reformulation of Rorschach variables. It is our belief that Rorschach himself would take such step. Our criteria for scoring this determinant are somewhat different of both Klopfer's and Piotrowski's. On the one hand, masks, facial traits, emotional expressions, body parts in motion are not entered there. On the other, we score as such human or animal movement, provided this does not originate in the blot shape directly, but in the subjective reaction against the sensed muscular tension. Basic requirement for this scoring is the kinesthetic component, as for Mever since Rorschach's elaboration; and common trait distinctive for any response to be so scored ? be it an abstraction, an inanimate object, an animal or human being ? must be the subjective way of feeling the movement: (a) intention, blocking, struggle for achieving, for instance, or (b) activity of nature elements. Due to this subjective meaning we use the symbol m'intead of mfor this category. We already find these two kinds (a) and (b) of movement responses in Rorschach's text, respectively in the Examplesand in his posthumous Contribution.Either may point to a flight from emotional stress or to outstanding mental ability.

Identidade social e auto conceito do dançarino em cadeira de rodas

Universidade Estadual de Campinas . Faculdade de Educação Física

Qualidade de vida de portadores de Diabetes Mellitus tipo II frente às oscilações no nível de atividade física, aspectos socioeconômicos e presença de comorbidades

Universidade Estadual de Campinas . Faculdade de Educação Física

Programação esportiva na TV Brasil : a influência da ideologia e indústria cultural

Universidade Estadual de Campinas . Faculdade de Educação Física

Auto-eficácia docente e motivação para a realização do(a) professor(a) de Educação Física Adaptada

Universidade Estadual de Campinas . Faculdade de Educação Física

A abordagem centrada na pessoa e a psicologia do esporte : vivência de um psicólogo com jogadores e a comissão técnica de uma equipe durante os períodos de preparação e disputa da Copa São Paulo de Futebol Júnior

Universidade Estadual de Campinas . Faculdade de Educação Física

Formação empirica na educação superior : um estudo de caso na Faculdade de Educação Fisica da Unicamp

Universidade Estadual de Campinas. Faculdade de Educação Física

Qualidade de vida e nivel de atividade fisica de funcionarios de empresa de tecnologia da comunicação

Universidade Estadual de Campinas . Faculdade de Educação Física