974 resultados para Breach of the peace
Resumo:
This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Type II 3β-hydroxysteroid dehydrogenase/Δ5-Δ4-isomerase (3β-HSD2), encoded by the HSD3B2 gene, is a key enzyme involved in the biosynthesis of all the classes of steroid hormones. Deleterious mutations in the HSD3B2 gene cause the classical deficiency of 3β-HSD2, which is a rare autosomal recessive disease that leads to congenital adrenal hyperplasia (CAH). CAH is the most frequent cause of ambiguous genitalia and adrenal insufficiency in newborn infants with variable degrees of salt losing. Here we report the molecular and structural analysis of the HSD3B2 gene in a 46,XY child, who was born from consanguineous parents, and presented with ambiguous genitalia and salt losing. The patient carries a homozygous nucleotide c.665C>A change in exon 4 that putatively substitutes the proline at codon 222 for glutamine. Molecular homology modeling of normal and mutant 3β-HSD2 enzymes emphasizes codon 222 as an important residue for the folding pattern of the enzyme and validates a suitable model for analysis of new mutations.
Resumo:
233
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
This in situ study investigated, using scanning electron microscopy, the effect of stimulated saliva on the enamel surface of bovine and human substrates submitted to erosion followed by brushing abrasion immediately or after one hour. During 2 experimental 7-day crossover phases, 9 previously selected volunteers wore intraoral palatal devices, with 12 enamel specimens (6 human and 6 bovine). In the first phase, the volunteers immersed the device for 5 minutes in 150 ml of a cola drink, 4 times a day (8h00, 12h00, 16h00 and 20h00). Immediately after the immersions, no treatment was performed in 4 specimens (ERO), 4 other specimens were immediately brushed (0 min) using a fluoride dentifrice and the device was replaced into the mouth. After 60 min, the other 4 specimens were brushed. In the second phase, the procedures were repeated but, after the immersions, the volunteers stimulated the salivary flow rate by chewing a sugar-free gum for 30 min. Enamel superficial alterations of all specimens were then evaluated using a scanning electron microscope. Enamel prism core dissolution was seen on the surfaces submitted to erosion, while on those submitted to erosion and to abrasion (both at 0 and 60 min) a more homogeneous enamel surface was observed, probably due to the removal of the altered superficial prism layer. For all the other variables - enamel substrate and salivary stimulation -, the microscopic pattern of the enamel specimens was similar.
Resumo:
OBJECTIVES: This study assessed the bone density gain and its relationship with the periodontal clinical parameters in a case series of a regenerative therapy procedure. MATERIAL AND METHODS: Using a split-mouth study design, 10 pairs of infrabony defects from 15 patients were treated with a pool of bovine bone morphogenetic proteins associated with collagen membrane (test sites) or collagen membrane only (control sites). The periodontal healing was clinically and radiographically monitored for six months. Standardized pre-surgical and 6-month postoperative radiographs were digitized for digital subtraction analysis, which showed relative bone density gain in both groups of 0.034 ± 0.423 and 0.105 ± 0.423 in the test and control group, respectively (p>0.05). RESULTS: As regards the area size of bone density change, the influence of the therapy was detected in 2.5 mm² in the test group and 2 mm² in the control group (p>0.05). Additionally, no correlation was observed between the favorable clinical results and the bone density gain measured by digital subtraction radiography (p>0.05). CONCLUSIONS: The findings of this study suggest that the clinical benefit of the regenerative therapy observed did not come with significant bone density gains. Long-term evaluation may lead to a different conclusions.
Resumo:
The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.
Resumo:
The objective of the present study was to determine whether lesion of the subthalamic nucleus (STN) promoted by N-methyl-D-aspartate (NMDA) would rescue nigrostriatal dopaminergic neurons after unilateral 6-hydroxydopamine (6-OHDA) injection into the medial forebrain bundle (MFB). Initially, 16 mg 6-OHDA (6-OHDA group) or vehicle (artificial cerebrospinal fluid - aCSF; Sham group) was infused into the right MFB of adult male Wistar rats. Fifteen days after surgery, the 6-OHDA and SHAM groups were randomly subdivided and received ipsilateral injection of either 60 mM NMDA or aCSF in the right STN. Additionally, a control group was not submitted to stereotaxic surgery. Five groups of rats were studied: 6-OHDA/NMDA, 6-OHDA/Sham, Sham/NMDA, Sham/Sham, and Control. Fourteen days after injection of 6-OHDA, rats were submitted to the rotational test induced by apomorphine (0.1 mg/kg, ip) and to the open-field test. The same tests were performed again 14 days after NMDA-induced lesion of the STN. The STN lesion reduced the contralateral turns induced by apomorphine and blocked the progression of motor impairment in the open-field test in 6-OHDA-treated rats. However, lesion of the STN did not prevent the reduction of striatal concentrations of dopamine and metabolites or the number of nigrostriatal dopaminergic neurons after 6-OHDA lesion. Therefore, STN lesion is able to reverse motor deficits after severe 6-OHDA-induced lesion of the nigrostriatal pathway, but does not protect or rescue dopaminergic neurons in the substantia nigra pars compacta.
Resumo:
The identification of the mandibular canal (MC) is an important prerequisite for surgical procedures involving the posterior mandible. Cone beam computed tomography (CBCT) represents an advance in imaging technology, but distinguishing the MC from surrounding structures may remain a delicate task. OBJECTIVES: The aim of this study was to assess the visibility of the MC in different regions on CBCT cross-sectional images. MATERIAL AND METHODS: CBCT cross-sectional images of 58 patients (116 hemi-mandibles) were analyzed, and the visibility of the MC in different regions was assessed. RESULTS: The MC was clearly visible in 53% of the hemi-mandibles. Difficult and very difficult visualizations were registered in 25% and 22% of the hemi-mandibles, respectively. The visibility of the MC on distal regions was superior when compared to regions closer to the mental foramen. No differences were found between edentulous and tooth-bearing areas. CONCLUSIONS: The MC presents an overall satisfactory visibility on CBCT cross-sectional images in most cases. However, the discrimination of the canal from its surrounds becomes less obvious towards the mental foramen region when cross-sectional images are individually analyzed.
Resumo:
This study evaluated in vitro the pulp chamber temperature rise induced by the light-activated dental bleaching technique using different light sources. The root portions of 78 extracted sound human mandibular incisors were sectioned approximately 2 mm below the cementoenamel junction. The root cavities of the crowns were enlarged to facilitate the correct placing of the sensor into the pulp chamber. Half of specimens (n=39) was assigned to receive a 35% hydrogen peroxide gel on the buccal surface and the other halt (n=39) not to receive the bleaching agent. Three groups (n=13) were formed for each condition (bleach or no bleach) according to the use of 3 light sources recommended for dental bleaching: a light-emitting diode (LED)laser system, a LED unit and a conventional halogen light. The light sources were positioned perpendicular to the buccal surface at a distance of 5 mm and activated during 30 s. The differences between the initial and the highest temperature readings for each specimen were obtained, and, from the temperature changes, the means for each specimen and each group were calculated. The values of temperature rise were compared using Kruskal-Wallis test at 1% significance level. Temperature rise varied significantly depending on the light-curing unit, with statistically significant differences (p<0.01) among the groups. When the bleaching agent was not applied, the halogen light induced the highest temperature rise (2.38±0.66ºC). The LED unit produced the lowest temperature increase (0.29±0.13ºC); but there was no significant difference between LED unit and LED-laser system (0.35±0.15ºC) (p>0.01). When the bleaching agent was applied, there were significant differences among groups (p<0.01): halogen light induced the highest temperature rise (1.41±0.64ºC), and LED-laser system the lowest (0.33±0.12ºC); however, there was no difference between LED-laser system and LED unit (0.44±0.11ºC). LED and LED-laser system did not differ significantly from each other regardless the temperature rise occurred with or without bleaching agent application. It may be concluded that during light-activated tooth bleaching, with or without the bleaching agent, halogen light promoted higher pulp chamber temperature rise than LED unit and LED-laser system. The tested light-curing units provided increases in the pulp chamber temperature that were compatible with pulpal health.
Resumo:
The aim of this in vitro study was to determine the maximum inhibitory dilution (MID) of four cetylpyridinium chloride (CPC)-based mouthwashes: CPC+Propolis, CPC+Malva, CPC+Eucaliptol+Juá+Romã+Propolis (Natural Honey®) and CPC (Cepacol®), against 28 Staphylococcus aureus field strains, using the agar dilution method. Decimal dilutions ranging from 1/10 to 1/655,360 were prepared and added to Mueller Hinton Agar. Strains were inoculated using Steers multipoint inoculator. The inocula were seeded onto the surface of the culture medium in Petri dishes containing different dilutions of the mouthwashes. The dishes were incubated at 37ºC for 24 h. For readings, the MID was considered as the maximum dilution of mouthwash still capable of inhibiting microbial growth. The obtained data showed that CPC+Propolis had antimicrobial activity against 27 strains at 1/320 dilution and against all 28 strains at 1/160 dilution, CPC+Malva inhibited the growth of all 28 strains at 1/320 dilution, CPC+Eucaliptol+Juá+Romã+Propolis inhibited the growth of 2 strains at 1/640 dilution and all 28 strains at 1/320 dilution, and Cepacol® showed antimicrobial activity against 3 strains at 1/320 dilution and against all 28 strains at 1/160 dilution. Data were submitted to Kruskal-Wallis test, showing that the MID of Cepacol® was lower than that determined for the other products (p<0.05). In conclusion, CPC-mouthwashes showed antimicrobial activity against S. aureus and the addition of other substances to CPC improved its antimicrobial effect.
Resumo:
This study evaluated the sealing ability of different lengths of remaining root canal filling and post space preparation against coronal leakage of Enterococcus faecalis. Forty-one roots of maxillary incisors were biomechanically prepared, maintaining standardized canal diameter at the middle and coronal thirds. The roots were autoclaved and all subsequent steps were undertaken in a laminar flow chamber. The canals of 33 roots were obturated with AH Plus sealer and gutta-percha. The root canal fillings were reduced to 3 predetermined lengths (n=11): G1=6 mm, G2=4 mm and G3=2 mm. The remaining roots served as positive and negative controls. Bacterial leakage test apparatuses were fabricated with the roots attached to Eppendorf tubes keeping 2 mm of apex submerged in BHI in glass flasks. The specimens received an E. faecalis inoculum of 1 x 107 cfu/mL every 3 days and were observed for bacterial leakage daily during 60 days. Data were submitted to ANOVA, Tukey's test and Fisher's test. At 60 days, G1 (6 mm) and G2 (4 mm) presented statistically similar results (p>0.05) (54.4% of specimens with bacterial leakage) and both groups differed significantly (p<0.01) from G3 (2 mm), which presented 100% of specimens with E. faecalis leakage. It may be concluded that the shortest endodontic obturation remnant leaked considerably more than the other lengths, although none of the tested conditions avoids coronal leakage of E. faecalis.