Papel das proteínas Nod na modulação da resposta imune nas doenças priodontais

Pós-graduação em Odontologia - FOAR

Ação antibacteriana de associações de antimicrobianos: nisina, óleos essenciais e compostos majotitários

Pós-graduação em Biologia Geral e Aplicada - IBB

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Análise da presença de vírus em alho semente da segunda e quarta gerações, produzidos por termoterapia e cultura de tecido

The garlic (Allium sativum L.) can be naturally infected by a complex of filamentous viruses belonging to the genera Potyvirus, Carlavirus and Allexivirus. Accumulation of these viruses occurs especially by vegetative propagation through cloves. As the cultivated garlic plant does not produce true seed worldwide, virus-free plants can only be obtained by tissue culture of stem apices and thermotherapy. Using these techniques, garlic seeds were produced at the School of Agricultural Sciences - UNESP, Botucatu, and evaluated by RT-PCR for the presence of potyvirus, carlavirus and allexivirus. In the second generation of microcloves propagated in a greenhouse, 6.6% infection was detected, only by allexivirus. In the fourth generation, however, there was 60% incidence by allexivirus, 35% by potyvirus and all negative by carlavirus. The high rate of infection by allexivirus may be related to the greater difficulty of removing the species of viruses belonging to this genus, as observed by other authors, and also based on the infection and transmission of the virus by the mite, Aceria tulipae, during the storage of bulbs from one year to the other. The garlic at the fourth generation corresponds to cloves weighed less than 1 gram and not selected for commercial multiplication. Selection for the size of cloves has a positive effect on the choice of cloves with lower rates of viral infection, as the technique of thermotherapy and tissue culture do not eliminate the virus completely. Results also emphasize the need of fumigation for the garlic seed stored from one year to the other in order to prevent the transmission of allexivirus during storage.

Biodegradacao da hepatotoxina(D-Leu1)-microcistina-LR por bactérias presentes em filtros biológicos de carvão

The persistence of MCs in aquatic environments and their difficult removal in the conventional water treatment is a challenge to companies of sanitation. However, the MCs are susceptible to degradation by bacteria present in water, sediment and sewage effluents. In this study, we investigated the biodegradation of MCs by microorganism present in carbon filters with biological activity (BAC) and their phylogenetic identification by sequencing gene 16S RNA. A study of water containing MCs was used, with different compositions, plus a filters BAC effluent. The results showed that of MCs were biodegraded by microorganism present in the biofilm. This study provides the ability to complete biodegradation of MCs by bacteria present in BAC filters and the possible use of these microorganisms as alternative of the removal of MCs in the treatment of drinking water

Modelo epidemiológico discreto para a transmissão de Acinetobacter baumannii em UTIs brasileiras

Pós-graduação em Biometria - IBB

Diversidade e evolução na simbiose entre bactérias e formigas Attini

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Detecção do operon ica da produção de biofilme, gene mecA de resistência à oxacilina e identificação de espécies de Staphylococcus spp. diretamente dos frascos de hemoculturas pela técnica de PCR multiplex

Pós-graduação em Doenças Tropicais - FMB

Eficiência agronômica de bactérias diazotróficas na cultura da cana-de-açúcar (Saccharum spp.)

Pós-graduação em Agronomia (Produção Vegetal) - FCAV

Interação entre bactérias diazotróficas e doses de n-fertilizante na cultura da cana-de-açúcar

Pós-graduação em Agronomia (Agricultura) - FCA

Condições bacteriológicas da superfície das poltronas hematológicas par hemodiálise

Pós-graduação em Enfermagem (mestrado profissional) - FMB

Ocorrências de bactérias solubilizadoras de fosfato de cálcio nas raízes de plantas na Amazônia brasileira

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Ácidos orgânicos isolados ou associados em dietas de frangos de corte

Pós-graduação em Ciência e Tecnologia Animal - FEIS

APPROXIMATE CALCULATION OF SUMS I: BOUNDS FOR THE ZEROS OF GRAM POLYNOMIALS

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Identificação de bactérias láticas e otimização da produção de ácido lático

O objetivo deste trabalho foi identificar o micro-organismo Y15C previamente isolado no laboratório de microbiologia industrial, da UNESP de Rio Claro, utilizando técnicas bioquímicas, além de otimizar a produção de ácido lático por meio de fermentação batelada simples e batelada alimentada. Considerando o potencial do micro-organismo para a produção de D(-) ácido lático, com 100% de pureza, isômero usado na síntese de polímeros empregados na produção de diversos materiais resistentes e biodegradáveis, foi feita a otimização do meio de cultura, tendo como fonte de carbono a manipueira. A manipueira por ser um resíduo do processamento da mandioca que contém grande quantidade de amido e quando hidrolisado pode ser uma fonte de carbono de baixo custo, quando utilizado pelo micro-organismo. O isolado Y15C foi identificado como Lactobacillus delbrueckii ssp delbrueckii, por meio de testes bioquímicos. Em relação à otimização dos parâmetros de fermentação, usando planejamento experimental, observou-se que a adição de componentes ao meio de cultivo, assim como a variação da temperatura não aumentou significamente a produção de ácido lático. Desta forma optou-se por trabalhar com as menores concentrações de AMM (1,6 mL/L) e citrato (0,96 g/L) e maior temperatura (43,4ºC). Para que haja aumento na produção de ácido lático podem ser realizados diversos tipos de fermentações, no caso deste trabalho foram comparados dois tipos de fermentação, batelada simples e batelada com alimentação constante. A maior concentração de ácido lático (41,6 g/L) foi observada que quando utilizada fermentação do tipo de fermentação em batelada... (Resumo completo, clicar acesso eletrônico abaixo)