An improved and fast UHPLC-PDA methodology for determination of L-ascorbic and dehydroascorbic acids in fruits and vegetables: evaluation of degradation rate during storage

This study provides a versatile validated method to determine the total vitamin C content, as the sum of the contents of L-ascorbic acid (L-AA) and dehydroascorbic acid (DHAA), in several fruits and vegetables and its degradability with storage time. Seven horticultural crops from two different origins were analyzed using an ultrahigh-performance liquid chromatographic–photodiode array (UHPLC-PDA) system, equipped with a new trifunctional high strength silica (100% silica particle) analytical column (100 mm×2.1 mm, 1.7 μm particle size) using 0.1% (v/v) formic acid as mobile phase, in isocratic mode. This new stationary phase, specially designed for polar compounds, overcomes the problems normally encountered in HPLC and is suitable for the analysis of large batches of samples without L-AA degradation. In addition, it proves to be an excellent alternative to conventional C18 columns for the determination of L-AA in fruits and vegetables. The method was fully validated in terms of linearity, detection (LOD) and quantification (LOQ) limits, accuracy, and inter/intraday precision. Validation experiments revealed very good recovery rate of 96.6±4.4% for L-AA and 103.1±4.8 % for total vitamin C, good linearity with r2-values >0.999 within the established concentration range, excellent repeatability (0.5%), and reproducibility (1.6%) values. The LOD of the method was 22 ng/mL whereas the LOQ was 67 ng/mL. It was possible to demonstrate that L-AA and DHAA concentrations in the different horticulture products varied oppositely with time of storage not always affecting the total amount of vitamin C during shelf-life. Locally produced fruits have higher concentrations of vitamin C, compared with imported ones, but vegetables showed the opposite trend. Moreover, this UHPLC-PDA methodology proves to be an improved, simple, and fast approach for determining the total content of vitamin C in various food commodities, with high sensitivity, selectivity, and resolving power within 3 min of run analysis.

Molecular analysis of the bacterial diversity in a specialized consortium for diesel oil degradation

Diesel oil is a compound derived from petroleum, consisting primarily of hydrocarbons. Poor conditions in transportation and storage of this product can contribute significantly to accidental spills causing serious ecological problems in soil and water and affecting the diversity of the microbial environment. The cloning and sequencing of the 16S rRNA gene is one of the molecular techniques that allows estimation and comparison of the microbial diversity in different environmental samples. The aim of this work was to estimate the diversity of microorganisms from the Bacteria domain in a consortium specialized in diesel oil degradation through partial sequencing of the 16S rRNA gene. After the extraction of DNA metagenomics, the material was amplified by PCR reaction using specific oligonucleotide primers for the 16S rRNA gene. The PCR products were cloned into a pGEM-T-Easy vector (Promega), and Escherichia coli was used as the host cell for recombinant DNAs. The partial clone sequencing was obtained using universal oligonucleotide primers from the vector. The genetic library obtained generated 431 clones. All the sequenced clones presented similarity to phylum Proteobacteria, with Gammaproteobacteria the most present group (49.8 % of the clones), followed by Alphaproteobacteira (44.8 %) and Betaproteobacteria (5.4 %). The Pseudomonas genus was the most abundant in the metagenomic library, followed by the Parvibaculum and the Sphingobium genus, respectively. After partial sequencing of the 16S rRNA, the diversity of the bacterial consortium was estimated using DOTUR software. When comparing these sequences to the database from the National Center for Biotechnology Information (NCBI), a strong correlation was found between the data generated by the software used and the data deposited in NCBI.

Hepatic mRNA expression and plasma levels of insulin-like growth factor-I (IGF-I) in broiler chickens selected for different growth rates

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Thyroid status, but not insulin status, affects expression of avian uncoupling protein mRNA in chicken

The aim of this study was to investigate the hormonal regulation of the avian homolog of mammalian uncoupling protein (avUCP) by studying the impact of thyroid hormones and insulin on avUCP mRNA expression in chickens (Gallus gallus). For 3 wk, chicks received either a standard diet (control group), or a standard diet supplemented with triiodothyronine (T-3; T3 group) or with the thyroid gland inhibitor methimazole (MMI group). A fourth group received injections of the deiodinase inhibitor iopanoic acid (IOP group). During the 4th wk of age, all animals received two daily injections of either human insulin or saline solution. The results indicate a twofold overexpression of avUCP mRNA in gastrocnemius muscle of T3 birds and a clear downregulation (-74%) in MMI chickens compared with control chickens. Insulin injections had no significant effect on avUCP mRNA expression in chickens. This study describes for the first time induction of avUCP mRNA expression by the thermogenic hormone T3 in chickens and supports a possible involvement of avUCP in avian thermogenesis.

Performance and carcass characteristics of Nellore young bulls fed different sources of oils, protected or not from rumen degradation

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

The relationship between pasture degradation and soil properties in the Brazilian amazon: a case study

Pasture degradation is one of the greatest problems related to land use in the Amazon region, forcing farmers to open new forest areas. Many studies have identified the causes and the factors involved in this degradation process, in an attempt to reverse the situation. The purpose of this study was to examine the relationship between pasture degradation and some soil properties, to try to identify the most significant soil features in the degradation process. A cattle raising farm in the eastern Amazon region, with pastures of different ages and degrees of degradation, was used as the site for this study: a primary forest area, PN; three Guinea grass (Panicum maximum Jacq.) pastures in an increasingly degraded sequence-P1, P2 and P3; one Gamba grass (Andropogon gayanus Kunth) pasture following an extremely degraded Guinea grass pasture, P4. Aboveground phytomass data showed differences between the pastures, reflecting initially observed degradation levels. Grass biomass decreased sharply from P1 to P2 and disappeared at P3. Pasture recovery with Gamba grass at P4 was very successful, with grass biomass higher than P1 and weed biomass smaller than P2 and P3. Root biomass also decreased with pasture degradation. Soil bulk density increased with pasture decrease at the topsoil layer. Results from the soil chemical analysis showed that there were no signs of decrease in organic carbon and total nitrogen after the forest was transformed into pasture. In all pastures, degraded or not, the soil pH, the sum of bases and the saturation degree were higher than in the forest soil. The extractable phosphorus content, lower in forest soil, remained quite stable in pasture soils, but it could become a limiting factor for the maintenance of Guinea grass. Results indicated that pasture degradation does not seem to be directly related to the modification of the chemical features of soils. (C) 2004 Elsevier B.V. All rights reserved.

Identification and migration of degradation compounds from irradiation of multilayer polyamide 6 films for meat foodstuffs and cheese

The aim of this work was to identify the degradation compounds produced during irradiation of multilayer polyamide 6 (PA-6) films and to study their migration into water and 95% ethanol food simulant. After irradiation of multilayer PA-6 films at 3, 7 and 12 kGy, degradation compounds were extracted using solid-phase microextraction, for which the time and temperature of extraction and stirring were optimized, and identified by gas chromatography-mass spectrometry. Caprolactam, 2-cyclopentylcyclopentanone and aldehydes, among other compounds, were identified in the headspace of the films. Polydimethylsiloxane was considered the best fiber for extraction. The optimum conditions of time, temperature and stirring to extract the compounds were 20 min, 80 degrees C and 225 rpm. For validation purposes, the compounds were quantified in water and 95% ethanol and the results showed high sensitivity, good precision and accuracy. Migration of compounds from irradiated and non-irradiated multilayer PA-6 films into water and 95% ethanol food simulants was carried out at 40 degrees C for 10 days. The method was efficient for the quantification of decaldehyde, 2-cyclopentylcyclopentanone and caprolactam that migrated from multilayer PA-6 films into food simulants.

Loss of nuclear poly(A)-binding protein 1 causes defects in myogenesis and mRNA biogenesis

The nuclear poly(A)-binding protein 1 (PABPN1) is a ubiquitously expressed protein that plays a critical role in polyadenylation. Short expansions of the polyalanine tract in the N-terminus of PABPN1 lead to oculopharyngeal muscular dystrophy (OPMD), which is an adult onset disease characterized by eyelid drooping, difficulty in swallowing and weakness in the proximal limb muscles. Although significant data from in vitro biochemical assays define the function of PABPN1 in control of poly(A) tail length, little is known about the role of PABPN1 in mammalian cells. To assess the function of PABPN1 in mammalian cells and specifically in cells affected in OPMD, we examined the effects of PABPN1 depletion using siRNA in primary mouse myoblasts from extraocular, pharyngeal and limb muscles. PABPN1 knockdown significantly decreased cell proliferation and myoblast differentiation during myogenesis in vitro. At the molecular level, PABPN1 depletion in myoblasts led to a shortening of mRNA poly(A) tails, demonstrating the cellular function of PABPN1 in polyadenylation control in a mammalian cell. In addition, PABPN1 depletion caused nuclear accumulation of poly(A) RNA, revealing that PABPN1 is required for proper poly(A) RNA export from the nucleus. Together, these experiments demonstrate that PABPN1 plays an essential role in myoblast proliferation and differentiation, suggesting that it is required for muscle regeneration and maintenance in vivo.

The effect of pH on horseradish peroxidase-catalyzed oxidation of melatonin: production of N-1-acetyl-N-2-formyl-5-methoxykynuramine versus radical-mediated degradation

There is a g-rowing body of evidence that melatonin and its oxidation product, N-1-acetyl-N-2-formyl-5-methoxykynuramine (AFMK), have anti-inflammatory properties. From a nutritional point of view, the discovery of melatonin in plant tissues emphasizes the importance of its relationship with plant peroxidases. Here we found that the pH of the reaction mixture has a profound influence in the reaction rate and products distribution when melatonin is oxidized by the plant enzyme horseradish peroxidase. At pH 5.5. 1 mm of melatonin was almost completely oxidized within 2 min, whereas only about 3% was consumed at pH 7.4. However, the relative yield of AFMK was higher in physiological pH. Radical-mediated oxidation products, including 2-hydroxymelatonin a dimer of, 2-hydroxymelatonin and O-demethylated dimer of melatonin account for the fast consumption of melatonin at pH 5.5. The higher production of AFMK at pH 7.4 was explained by the involvement of compound III of peroxidases as evidenced by spectral studies. on the other hand, the fast oxidative degradation at pH 5.5 was explained by the classic peroxidase cycle.

An interaction between two RNA binding proteins, Nab2 and Pub1, links mRNA Processing/Export and mRNA stability

mRNA stability is modulated by elements in the mRNA transcript and their cognate RNA binding proteins. Poly(U) binding protein 1 (Pub1) is a cytoplasmic Saccharomyces cerevisiae mRNA binding protein that stabilizes transcripts containing AU-rich elements (AREs) or stabilizer elements (STEs). In a yeast two-hybrid screen, we identified nuclear poly(A) binding protein 2 (Nab2) as being a Pub1-interacting protein. Nab2 is an essential nucleocytoplasmic shuttling mRNA binding protein that regulates poly(A) tail length and mRNA export. The interaction between Pub1 and Nab2 was confirmed by copurification and in vitro binding assays. The interaction is mediated by the Nab2 zinc finger domain. Analysis of the functional link between these proteins reveals that Nab2, like Pub1, can modulate the stability of specific mRNA transcripts. The half-life of the RPS16B transcript, an ARE-like sequence-containing Pub1 target, is decreased in both nab2-1 and nab2-67 mutants. In contrast, GCN4, an STE-containing Pub1 target, is not affected. Similar results were obtained for other ARE- and STE-containing Pub1 target transcripts. Further analysis reveals that the ARE-like sequence is necessary for Nab2-mediated transcript stabilization. These results suggest that Nab2 functions together with Pub1 to modulate mRNA stability and strengthen a model where nuclear events are coupled to the control of mRNA turnover in the cytoplasm.

Development of a Validated Stability-Indicating LC Assay and Stress Degradation Studies of Linezolid in Tablets

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Dexamethasone-induced insulin resistance is associated with increased connexin 36 mRNA and protein expression in pancreatic rat islets

Augmented glucose-stimulated insulin secretion (GSIS) is an adaptive mechanism exhibited by pancreatic islets from insulin-resistant animal models. Gap junction proteins have been proposed to contribute to islet function. As such, we investigated the expression of connexin 36 (Cx36), connexin 43 (Cx43), and the glucose transporter Glut2 at mRNA and protein levels in pancreatic islets of dexamethasone (DEX)-induced insulin-resistant rats. Study rats received daily injections of DEX (1 mg/kg body mass, i.p.) for 5 days, whereas control rats (CTL) received saline solution. DEX rats exhibited peripheral insulin resistance, as indicated by the significant postabsorptive insulin levels and by the constant rate for glucose disappearance (K-ITT). GSIS was significantly higher in DEX islets (1.8-fold in 16.7 mmol/L glucose vs. CTL, p < 0.05). A significant increase of 2.25-fold in islet area was observed in DEX vs. CTL islets (p < 0.05). Cx36 mRNA expression was significantly augmented, Cx43 diminished, and Glut2 mRNA was unaltered in islets of DEX vs. CTL (p < 0.05). Cx36 protein expression was 1.6-fold higher than that of CTL islets (p < 0.05). Glut2 protein expression was unaltered and Cx43 was not detected at the protein level. We conclude that DEX-induced insulin resistance is accompanied by increased GSIS and this may be associated with increase of Cx36 protein expression.