Utilização de 1-metilciclopropeno e resfriamento rápido na conservação de pêssegos

Postharvest losses vary among the different vegetable products. However, among fruits and vegetables the losses generally range from 30% to 50%. Thus, this paper aimed the application of 1-methylcycloprene (1-MCP) and fast cooling with forced air (PC) on peaches, in order to estimate their effects in the ripening process of this fruit. Physiological analyses were performed, such as loss of fresh mass, firmness, pH, titratable acidity, soluble solids, ratio and CO2 production, as well as sensorial analyses such as color, texture and flavor. The experiment was divided in two phases. In the first one, concentrations of 30, 60, and 90 nL/L 1-MCP, applied at 0 ºC and 20 ºC, were tested. The fruits treated without 1-MCP were denominated control for both temperatures studied. The second phase was composed by the following treatments: cold storage (CS) or control, cooling with forced air (CFA), cooling with forced air followed by 1-MCP application (CFA + 1-MCP) and 1-MCP application (1-MCP). Among these, the CFA + 1-MCP treatment provided more firmness of the fruits in comparison to the control fruits. The respiratory rate of peaches under CFA and CFA + 1-MCP treatments decreased in comparison to the control fruit respiratory rates.

Caracterização de dois equipamentos de beneficiamento e classificação de tomates para mesa

On the last years, in Brazil, sorting and classifying fruits and vegetables using packing lines have increased. This work aimed at characterizing the cleaning process for fresh market tomatoes at two packing lines, one imported and one national located at Campinas, São Paulo State. Characterization included data, number, types and brushes velocity, water use, fruit standing time and cleaning efficiency. Standing time was measured correlating to fruit diameter (CEAGESP). For measuring cleaning efficiency an equipment was developed that was mainly composed of a ring involved with white cloth. Samples were taken before and after the cleaning step and evaluated using a colorimeter HUNTER Lab. The results showed a strong difference between the two equipments. The imported equipment showed lower number on brushes and rotation than national one, however a higher water consumption. For imported equipments this relation was not found. Both packing lines showed the same cleaning efficiency. Cleaning efficiency is related to be an interaction among the studies parameters, and it could be necessary a better management than the one used on both equipments.

Avaliação de índices de firmeza para abacaxi minimamente processado em fatias tratadas com soluções de sais de cálcio

Fresh-cut sliced fruits and vegetables are ready to eat immediately and their sensorial characteristics should be similar to fresh product. Although most of the studies in this area are focused on vegetables, there is a great market potential for fresh-cut sliced fruits, mainly for those which exhibit some commercialization or preparation difficulties such as pineapple. The objective of this work was to evaluate the effect of 1% and 3% concentrations of calcium salts (chloride, sulphate and lactate) on pH, total soluble solids and firmness values of minimally processed pineapple slices. Two types of indenters and three firmness indexes were investigated aiming to identify the best index. Results showed that calcium sulphate 3% kept average firmness index up to 44.45% higher than the index value of the control. Even though both indenters exhibited similar variability the cylindrical one was able to point out more differences between control and treatments than the cylindrical borer indenter.

Projeto de caixa de madeira para manga (Mangifera Indica L.)

Losses of horticulture product in Brazil are significant and among the main causes are the use of inappropriate boxes and the absence of a cold chain. A project for boxes is proposed, based on computer simulations, optimization and experimental validation, trying to minimize the amount of wood associated with structural and ergonomic aspects and the effective area of the openings. Three box prototypes were designed and built using straight laths with different configurations and areas of openings (54% and 36%). The cooling efficiency of Tommy Atkins mango (Mangifera Indica L.) was evaluated by determining the cooling time for fruit packed in the wood models and packed in the commercially used cardboard boxes, submitted to cooling in a forced-air system, at a temperature of 6ºC and average relative humidity of 85.4±2.1%. The Finite Element Method was applied, for the dimensioning and structural optimization of the model with the best behavior in relation to cooling. All wooden boxes with fruit underwent vibration testing for two hours (20 Hz). There was no significant difference in average cooling time in the wooden boxes (36.08±1.44 min); however, the difference was significant in comparison to the cardboard boxes (82.63±29.64 min). In the model chosen for structural optimization (36% effective area of openings and two side laths), the reduction in total volume of material was 60% and 83% in the cross section of the columns. There was no indication of mechanical damage in the fruit after undergoing the vibration test. Computer simulations and structural study may be used as a support tool for developing projects for boxes, with geometric, ergonomic and thermal criteria.

Qualidade pós-colheita de caqui 'fuyu' com utilização de diferentes concentrações de cobertura comestível

One of the main objectives of applying edible coatings on fruits surface is to create a protective film to reduce weight loss due to evaporation and transpiration and also to decrease the risk of fruit rot caused by environmental contamination, in order to improve the visual aspect. Therefore, it is possible to increase shelf life, and decrease post harvest losses. Persimmon is a much appreciated fruit, with high potential for export, but sensitive to handling and storage. This study aimed to evaluate the effect of applying the edible coating Megh Wax ECF-124 (18% of active composts, consisting of emulsion of carnauba wax, anionic surfactant, preservative and water) produced by Megh Industry and Commerce Ltda in three different concentrations (25, 50 and 100%) on post harvest quality of 'Fuyu' persimmon stored for 14 days. The attributes evaluated for quality were: firmness, pH, acidity, soluble solids, weight loss and color. The results showed that application of carnauba wax in different concentrations was effective on decreasing weight loss of persimmon cv. Fuyu and maintenance of color aspects. Treatment at lower concentration, 25%, showed lower rate of discharge, but high concentrations showed lower values of mass loss. Carnauba wax application showed a high potential for use on postharvest conservation, and can be applied together with other technologies, helping to maintain quality for export.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Efeitos da atividade fisica sobre o sistema locomotor e nos habitos de vida

Universidade Estadual de Campinas. Faculdade de Educação Física

Endodontic treatment of dental formation anomalies

PURPOSE: Dental fusion is defined as the union of two dental germs at some stage of their development. The aim of this article is to report the endodontic treatment of two clinical cases of dental fusion. CASE DESCRIPTION: In the first case, the patient was referred by an orthodontist for endodontic treatment of tooth 12, which was fused to 13. Surgical separation and later replacement of the involved elements in the dental arch was indicated. In the second case, the patient sought dental attendance due to spontaneous pain. In the radiographic exam, gemination in tooth 11 and fusion of 21 with a supernumerary tooth was observed. The fused teeth were endodontically treated, and patients were referred to other dental specialties to reestablish esthetics and function. CONCLUSION: The dentist must be able to diagnose, differentiate and treat these dental anomalies adequately, with the goal of maintaining patients' oral health.

Thermal performance of sisal fiber-cement roofing tiles for rural constructions

Roofing provides the main protection against direct solar radiation in animal housing. Appropriate thermal properties of roofing materials tend to improve the thermal comfort in the inner ambient. Nonasbestos fiber-cement roofing components reinforced with cellulose pulp from sisal (Agave sisalana) were produced by slurry and dewatering techniques, with an optional addition of polypropylene fibers. Nonasbestos tiles were evaluated and compared with commercially available asbestos-cement sheets and ceramic tiles (frequently chosen as roofing materials for animal housing). Thermal conductivity and thermal diffusivity of tiles were determined by the parallel hot-wire method, along with the evaluation of the downside surface temperature. Cement-based components reinforced with sisal pulp presented better thermal performance at room temperature (25ºC), while those reinforced with sisal pulp added by polypropylene fibers presented better thermal performance at 60ºC. Non-asbestos cement tiles provided more efficient protection against radiation than asbestos corrugated sheets.

Integração vertical como estratégia de apropriação de valor: um estudo exploratório no canal de distribuição de produtos agrícolas

Neste artigo, investiga-se a adoção de canais alternativos para a comercialização de produtos agrícolas como forma de atenuar o poder, cada vez maior, exercido pelas grandes redes varejistas. O artigo investiga a decisão - e os efeitos daí decorrentes - de uma determinada empresa sediada no interior paulista, agrícola Pedra Branca, quanto à operacionalização verticalizada de uma butique de frutas, legumes e verduras (FLVs). Consciente dos novos padrões demandados pelo consumidor, a estratégia da empresa alvo do estudo foi combinar a oferta regular de produtos frescos, de qualidade intrínseca padronizada e preços atrativos, a um serviço diferenciado, baseado em um alto valor na experiência de compra. Esta estratégia fundamenta-se no anseio dos consumidores de, mais do que simplesmente adquirir produtos, experimentar sensações, as quais vividas em momentos de lazer exerceriam um grande poder de diferenciação. Realizou-se um estudo de caso baseado em entrevistas em profundidade semiestruturadas com diretores e gerentes da empresa. Como resultado, as evidências empíricas sugerem: 1) a verticalização (integração vertical) da atividade de comercialização como uma alternativa para a apropriação de valor da produção ao longo do canal de distribuição; e 2) o desafio da gestão do suprimento como requisito-chave para a adequada gestão do valor de uma marca. Considera-se oportuno lembrar, porém, que, em decorrência das limitações próprias da metodologia de estudos de caso, estas tais evidências devem ser entendidas como proposição a ser testada em trabalhos quantitativos futuros, ou mesmo melhor embasada via condução de estudos multicaso.

Propiedades termodinámicas de sorción de agua de la pulpa de lulo en polvo con encapsulantes

Datos de humedad de equilibrio de polvo de pulpa de lulo (PL) con y sin aditivos - 58% de maltodextrina (MD) o 58% de goma Arábiga (GA) - fueran determinados en las temperaturas de 20, 30, 40 y 50 °C utilizando el método estático gravimétrico para un rango de actividades de agua entre 0.06 y 0.90. Las isotermas presentaran formato sigmoidal del tipo III, y el modelo de Guggenhein-Anderson-de Boer (GAB) fue ajustado satisfactoriamente a los datos experimentales de humedad de equilibrio en función de la actividad de agua. La adición de encapsulantes afecto las isotermas de tal manera que en la misma actividad de agua, las muestras PL + GA y PL + MD presentaron un menor contenido de humedad de equilibrio y no fueron afectadas por la variación de temperatura. Los calores isostéricos de sorción de las pulpas en polvo con encapsulantes fueron mayores (menos negativos) con relación a las pulpas de lulo en polvo, sugiriendo la existencia de sitios polares más activos en el producto sin adición de GA o MD. Una relación exponencial empírica fue utilizada para describir la dependencia del calor de sorción con el contenido de humedad del material.

Effects of dietary energy and nitrogen supplements on rumen fermentation and protozoa population in buffalo and zebu cattle

The effects were assessed of two energy sources in concentrate (ground grain corn vs. citrus pulp) and two nitrogen sources (soybean meal vs. urea) on rumen metabolism in four buffaloes and four zebu cattle (Nellore) with rumen cannula and fed in a 4 × 4 Latin square design with feeds containing 60% sugar cane. Energy supplements had no effect on the rumen ammonia concentration in cattle, but ground grain corn promoted higher ammonia level than citrus pulp in buffalo. Urea produced higher ammonia level than soybean meal in both animal species. On average, the buffaloes maintained a lower rumen ammonia concentration (11.7 mg/dL) than the cattle (14.5 mg/dL). Buffaloes had lower production of acetic acid than cattle (58.7 vs. 61.6 mol/100 mol) and higher of propionic acid (27.4 vs. 23.6 mol/100 mol). There was no difference in the butyric acid production between the buffaloes (13.6 mol/100 mol) and cattle (14.8 mol/100 mol) and neither in the total volatile fatty acids concentration (82.5 vs. 83.6 mM, respectively). The energy or nitrogen sources had no effect on rumen protozoa count in either animal species. The zebu cattle had higher rumen protozoa population (8.8 × 10(5)/mL) than the buffaloes (6.1 × 10(5)/mL). The rumen protozoa population differed between the animal species, except for Dasytricha and Charonina. The buffaloes had a lower Entodinium population than the cattle (61.0 vs 84.9%, respectively) and a greater percentage of species belonging to the Diplodiniinae subfamily than the cattle (28.6 vs. 1.4%, respectively). In cattle, ground corn is a better energy source than citrus pulp for use by Entodinium and Diplodiniinae. In the buffaloes, the Entodinium are favored by urea and Diplodiniinae species by soybean meal.

Successful transplant of mesenchymal stem cells in induced osteonecrosis of the ovine femoral head: preliminary results

PURPOSE: Evaluate the bone tissue recovery following transplantation of ovine mesenchymal stem cells (MSC) from bone marrow and human immature dental-pulp stem cells (hIDPSC) in ovine model of induced osteonecrosis of femoral head (ONFH). METHODS: Eight sheep were divided in three experimental groups. First group was composed by four animals with ONFH induced by ethanol through central decompression (CD), for control group without any treatment. The second and third group were compose by two animals, six weeks after ONFH induction received transplantation of heterologous ovine MSC (CD + oMSC), and hIDPSC (CD + hIDPSC), respectively. In both experiments the cells were transplanted without application of any type of immunosupression protocol. RESULTS: Our data indicate that both cell types used in experiments were able to proliferate within injured site providing bone tissue recovery. The histological results obtained from CD+hIDPSC suggested that the bone regeneration in such animals was better than that observed in CD animals. CONCLUSION: Mesenchymal stem cell transplant in induced ovine osteonecrosis of femoral head by central decompression technique is safe, and apparently favors bone regeneration of damaged tissues.

Maracujá: um alimento funcional?

Este artigo é uma revisão bibliográfica sobre as espécies brasileiras de Passiflora (Passiflora edulis fo. flavicarpa O. Deg., P. alata Curtis e P. edulis fo. edulis). A maioria dos artigos da literatura focaliza somente as folhas de Passiflora, enquanto que esta revisão contém informações sobre a polpa, cascas e sementes dos frutos do maracujá, com destaque para a composição química, estudos nutricionais e farmacológicos. O enfoque nos frutos do maracujá fundamenta-se no amplo consumo do suco de maracujá (fresco ou industrializado) no Brasil e também nas investigações em andamento para avaliar o seu potencial uso como alimento funcional.

Stability of fruit bases and chocolate fillings

Syrups with high sugar content and dehydrated fruits in its composition can be added to chocolate fillings to reduce the need of artificial flavor and dyes attributing a natural appeal to the product. Fruit bases were produced with lyophilized strawberry, passion fruit, and sliced orange peel. Rheological dynamic oscillatory tests were applied to determine the products stability and tendency of shelf life. Values of G´< G´´ were observed for strawberry and passion fruit flavor, whereas values of G´ > G´´ were found for orange flavor during the 90 days of storage. It was observed that shear stress values did not vary significantly suggesting product stability during the studied period. For all fillings, it was found a behavior similar to the fruit base indicating that it has great influence on the filling behavior and its stability. The use of a sugar matrix in fillings provided good shelf life for the fruit base, which could be kept under room temperature conditions for a period as long as one year. The good stability and storage conditions allow the use of fruit base for handmade products as well as for industrialized products.