953 resultados para Male-specific SCAR marker (MSM)


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Although benign epilepsy with centrotemporal spikes (BECTS) is an idiopathic, age-related epilepsy syndrome with favorable outcome, recent studies have shown impairment in specific neuropsychological tests. The objective of this study was to analyze the comorbidity between dyslexia and BECTS. Thirty-one patients with clinical and electroencephalographic diagnosis of BECTS (group A) and 31 paired children (group B) underwent a language and neuropsychological assessment performed with several standardized protocols. Our findings were categorized as: a) dyslexia; b) other difficulties; c) without difficulties. Our results were compared and statistically analyzed. Our data showed that dyslexia occurred in 19.4% and other difficulties in 74.2% of our patients. This was highly significant when compared with the control group (p<0.001). Phonological awareness, writing, reading, arithmetic, and memory tests showed a statistically significant difference when comparing both groups. Our findings show significant evidence of the occurrence of dyslexia in patients with BECTS.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To evaluate p16(INK) (4a) immunoexpression in CIN1 lesions looking for differences between cases that progress to CIN2/3 maintain CIN1 diagnosis, or spontaneously regress. Seventy-four CIN1 biopsies were studied. In the follow-up, a second biopsy was performed and 28.7% showed no lesion (regression), 37.9% maintained CIN1, and 33.4% progressed to CIN2/3. Immunostaining for p16(INK) (4a) was performed in the first biopsy and it was considered positive when there was strong and diffuse staining of the basal and parabasal layers. Pearson's chi-square was used to compare the groups (p ≤ 0.05). The age of the patients was similar. There was no significant difference in p16(INK) (4a) immunoexpression in the groups, however, statistical analyses showed a significant association when only the progression and regression groups were compared (p = 0.042). Considering p16(INK) (4a) positivity and the progression to CIN2/3, the sensitivity, specificity, positive, and negative predictive values in our cohort were 45%, 75%, 47%, and 94%, respectively. We emphasize that CIN1 with p16(INK) (4a) staining was associated with lesion progression, but the sensitivity was not high. However, the negative predictive value was more reliable (94%) and p16(INK) (4a) may represent a useful biomarker that can identify CIN1 lesions that need particular attention, complementing morphology.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The purpose of this study was to compare the serum levels of androgens between hyposexual and non-hyposexual patients with epilepsy. Adult male patients with epilepsy were investigated. Serum levels of testosterone (T) and free-T, estradiol, and sex hormone binding globulin (SHBG) were measured and the free androgen index (FAI) was calculated. While there were no differences between hyposexual and non-hyposexual patients in the serum levels of T, free-T, and estradiol, or to the FAI, the serum levels of SHBG were significantly higher in hyposexual patients than in non-hyposexual patients. Thus, the effects of increased SHBG upon serum levels of testosterone biologically active in patients with epilepsy and hyposexuality were not detected by the methods used in this study. Four (44%) of nine hyposexual patients who were re-evaluated after two years follow-up improved sexual performance. Thus, clinical treatment that results in good seizure control may improve sexual performance in some patients with epilepsy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this paper we present a study of reading comprehension based on a contrastive argumentative-discursive approach. We examine the relationship between linguistic materiality and discursive processes, observing the connection between reading in a foreign language, writing production and textual memories in the mother tongue. In addition to an interest in practical language teaching and learning processes (in this case of Spanish and Portuguese), we investigate the question of politeness and the theoretical relationship between subjectivity, language, and textuality. The latter, being understood as the result of discourse regularities, is unique for each and every production, yet is also conditioned by plural discursive memories resulting from contradictory social relationships in a specific historical context (Foucault, 1986; Pêcheux, 1990). In the experiment presented here, we follow some of the procedures of the methodology applied in the European Galatea Project developed for the study of reading strategies in the inter-comprehension between Romance languages (Dabène, 1996). We use the procedure of simulation and the subjective projection of participants as well as the notion of discursive resonance in the analysis. The results, having to do with directness and indirectness in speech and the question of politeness in two typologically close languages, lead to the conclusion that the concept of politeness goes beyond a pragmatic strategy used to avoid conflicts to be approached as a marker of cultural identity constitution. The relevance of discursive awareness and its theoretical and practical consequences are then emphasized.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The XX male syndrome - Testicular Disorder of Sexual Differentiation (DSD) is a rare condition characterized by a spectrum of clinical presentations, ranging from ambiguous to normal male genitalia. We report hormonal, molecular and cytogenetic evaluations of a boy presenting with this syndrome. Examination of the genitalia at age of 16 months, showed: penis of 3.5 cm, proximal hypospadia and scrotal testes. Pelvic ultrasound did not demonstrate Mullerian duct structures. Karyotype was 46,XX. Gonadotrophin stimulation test yielded insufficient testosterone production. Gonadal biopsy showed seminiferous tubules without evidence of Leydig cells. Molecular studies revealed that SRY and TSPY genes and also DYZ3 sequences were absent. In addition, the lack of deletions or duplications of SOX9, NR5A1, WNT4 and NROB1 regions was verified. The infant was heterozygous for all microsatellites at the 9p region, including DMRT1 gene, investigated. Only 10% of the patients are SRY-negative and usually they have ambiguous genitalia, as the aforementioned patient. The incomplete masculinization suggests gain of function mutation in one or more genes downstream to SRY gene.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física