993 resultados para Fungus Rhizoctonia-solani
Resumo:
O presente trabalho objetivou avaliar o efeito de doses (1,25; 2,5; 5,0 e 10 mL L-1) de fosfito de potássio no crescimento micelial e na germinação de conídios de Fusarium solani f. sp. cucurbitae, agente causal da podridão-do-colo e raízes do meloeiro. Foram avaliadas as doses 1,25; 2,5; 5,0 e 10 mL L-1 dos fosfitos, uma testemunha apenas com água (dose ?0?) e o fungicida tebuconazol + trifloxistrobina (1,0 mL L-1). As formulações de fosfito de potássio avaliadas proporcionaram toxidez direta a F. solani f. sp. cucurbitae, apresentando efeito significativo de doses no crescimento micelial e germinação de conídios do fungo. Contudo, observou-se maior efeito das formulações de fosfitos na inibição da germinação (DL50 =1,7 e 1,1 mL-1) do que na inibição do crescimento micelial (DL50 >10 mL-1 para os dois fosfitos). Na maior dose avaliada (10 mL L-1), a inibição do crescimento micelial foi de 33% e 18%, na dose de 5 mL L-1 as formulações inibiram a germinação em 88% e 89%. O fungicida inibiu totalmente o crescimento micelial e em inibiu a germinação dos conídios em torno de 99%, diferindo dos demais tratamentos.
Resumo:
Paracoccidioidomycosis is a systemic mycosis that is endemic to certain countries in Latin America. This study aimed to describe the histological features of liver involvement in patients with paracoccidioidomycosis aged <16 years of age who were treated between 1980 and 2010, with a diagnosis that was confirmed by detection of the fungus by pathological examination. Liver tissue was obtained from one necropsy and 12 biopsies. Throughout 2007, biopsies were taken from patients with persistent jaundice or portal hypertension, after which biopsies became indicated due to elevated aminotransferase and low albumin levels. Using haematoxylin and eosin (H&E), Masson's trichrome and immunohistochemical (CK7 and CK19) staining, we noted degenerative alterations in bile duct cells and inflammatory injury to the bile ducts in 10 biopsies. Using immunohistochemistry for CK7 and CK19, we observed ductal proliferation in all 12 samples. Bile duct injuries by inflammatory cells might explain the predominant increase in canalicular enzymes; immunohistochemistry is more sensitive in demonstrating ductular reactions and might show changes that are not apparent on H&E staining.
Resumo:
The basidiomycete fungus Gloeophyllum trabeum causes a typical brown rot and is known to use reactive oxygen species in the degradation of cellulose. The extracellular Cel12A is one of the few endo-1,4-β-glucanase produced by G. trabeum. Here we cloned cel12A and heterologously expressed it in Aspergillus niger. The identity of the resulting recombinant protein was confirmed by mass spectrometry. We used the purified GtCel12A to determine its substrate specificity and basic biochemical properties. The G. trabeum Cel12A showed highest activity on β-glucan, followed by lichenan, carboxymethylcellulose, phosphoric acid swollen cellulose, microcrystalline cellulose, and filter paper. The optimal pH and temperature for enzymatic activity were, respectively, 4.5 and 50 °C on β-glucan. Under these conditions specific activity was 239.2 ± 9.1 U mg(-1) and the half-life of the enzyme was 84.6 ± 3.5 hours. Thermofluor studies revealed that the enzyme was most thermal stable at pH 3. Using β-glucan as a substrate, the Km was 3.2 ± 0.5 mg mL(-1) and the Vmax was 0.41 ± 0.02 µmol min(-1). Analysis of the effects of GtCel12A on oat spelt and filter paper by scanning electron microscopy revealed the morphological changes taking place during the process.
Resumo:
The 'dilution effect' (DE) hypothesis predicts that diverse host communities will show reduced disease. The underlying causes of pathogen dilution are complex, because they involve non-additive (driven by host interactions and differential habitat use) and additive (controlled by host species composition) mechanisms. Here, we used measures of complementarity and selection traditionally employed in the field of biodiversity-ecosystem function (BEF) to quantify the net effect of host diversity on disease dynamics of the amphibian-killing fungus Batrachochytrium dendrobatidis (Bd). Complementarity occurs when average infection load in diverse host assemblages departs from that of each component species in uniform populations. Selection measures the disproportionate impact of a particular species in diverse assemblages compared with its performance in uniform populations, and therefore has strong additive and non-additive properties. We experimentally infected tropical amphibian species of varying life histories, in single- and multi-host treatments, and measured individual Bd infection loads. Host diversity reduced Bd infection in amphibians through a mechanism analogous to complementarity (sensu BEF), potentially by reducing shared habitat use and transmission among hosts. Additionally, the selection component indicated that one particular terrestrial species showed reduced infection loads in diverse assemblages at the expense of neighbouring aquatic hosts becoming heavily infected. By partitioning components of diversity, our findings underscore the importance of additive and non-additive mechanisms underlying the DE.
Resumo:
Witches' broom disease (WBD), caused by the hemibiotrophic fungus Moniliophthora perniciosa, is one of the most devastating diseases of Theobroma cacao, the chocolate tree. In contrast to other hemibiotrophic interactions, the WBD biotrophic stage lasts for months and is responsible for the most distinctive symptoms of the disease, which comprise drastic morphological changes in the infected shoots. Here, we used the dual RNA-seq approach to simultaneously assess the transcriptomes of cacao and M. perniciosa during their peculiar biotrophic interaction. Infection with M. perniciosa triggers massive metabolic reprogramming in the diseased tissues. Although apparently vigorous, the infected shoots are energetically expensive structures characterized by the induction of ineffective defense responses and by a clear carbon deprivation signature. Remarkably, the infection culminates in the establishment of a senescence process in the host, which signals the end of the WBD biotrophic stage. We analyzed the pathogen's transcriptome in unprecedented detail and thereby characterized the fungal nutritional and infection strategies during WBD and identified putative virulence effectors. Interestingly, M. perniciosa biotrophic mycelia develop as long-term parasites that orchestrate changes in plant metabolism to increase the availability of soluble nutrients before plant death. Collectively, our results provide unique insight into an intriguing tropical disease and advance our understanding of the development of (hemi)biotrophic plant-pathogen interactions.
Resumo:
The phytopathogenic fungus Moniliophthora perniciosa (Stahel) Aime & Philips-Mora, causal agent of witches' broom disease of cocoa, causes countless damage to cocoa production in Brazil. Molecular studies have attempted to identify genes that play important roles in fungal survival and virulence. In this study, sequences deposited in the M. perniciosa Genome Sequencing Project database were analyzed to identify potential biological targets. For the first time, the ergosterol biosynthetic pathway in M. perniciosa was studied and the lanosterol 14α-demethylase gene (ERG11) that encodes the main enzyme of this pathway and is a target for fungicides was cloned, characterized molecularly and its phylogeny analyzed. ERG11 genomic DNA and cDNA were characterized and sequence analysis of the ERG11 protein identified highly conserved domains typical of this enzyme, such as SRS1, SRS4, EXXR and the heme-binding region (HBR). Comparison of the protein sequences and phylogenetic analysis revealed that the M. perniciosa enzyme was most closely related to that of Coprinopsis cinerea.
Resumo:
Witches' broom disease (WBD) of cacao differs from other typical hemibiotrophic plant diseases by its unusually long biotrophic phase. Plant carbon sources have been proposed to regulate WBD developmental transitions; however, nothing is known about their availability at the plant-fungus interface, the apoplastic fluid of cacao. Data are provided supporting a role for the dynamics of soluble carbon in the apoplastic fluid in prompting the end of the biotrophic phase of infection. Carbon depletion and the consequent fungal sensing of starvation were identified as key signalling factors at the apoplast. MpNEP2, a fungal effector of host necrosis, was found to be up-regulated in an autophagic-like response to carbon starvation in vitro. In addition, the in vivo artificial manipulation of carbon availability in the apoplastic fluid considerably modulated both its expression and plant necrosis rate. Strikingly, infected cacao tissues accumulated intracellular hexoses, and showed stunted photosynthesis and the up-regulation of senescence markers immediately prior to the transition to the necrotrophic phase. These opposite findings of carbon depletion and accumulation in different host cell compartments are discussed within the frame of WBD development. A model is suggested to explain phase transition as a synergic outcome of fungal-related factors released upon sensing of extracellular carbon starvation, and an early senescence of infected tissues probably triggered by intracellular sugar accumulation.
Resumo:
Neutrophils (PMN) play a central role in host defense against the neglected fungal infection paracoccidioidomycosis (PCM), which is caused by the dimorphic fungus Paracoccidioides brasiliensis (Pb). PCM is of major importance, especially in Latin America, and its treatment relies on the use of antifungal drugs. However, the course of treatment is lengthy, leading to side effects and even development of fungal resistance. The goal of the study was to use low-level laser therapy (LLLT) to stimulate PMN to fight Pb in vivo. Swiss mice with subcutaneous air pouches were inoculated with a virulent strain of Pb or fungal cell wall components (Zymosan), and then received LLLT (780 nm; 50 mW; 12.5 J/cm2; 30 seconds per point, giving a total energy of 0.5 J per point) on alternate days at two points on each hind leg. The aim was to reach the bone marrow in the femur with light. Non-irradiated animals were used as controls. The number and viability of the PMN that migrated to the inoculation site was assessed, as well as their ability to synthesize proteins, produce reactive oxygen species (ROS) and their fungicidal activity. The highly pure PMN populations obtained after 10 days of infection were also subsequently cultured in the presence of Pb for trials of protein production, evaluation of mitochondrial activity, ROS production and quantification of viable fungi growth. PMN from mice that received LLLT were more active metabolically, had higher fungicidal activity against Pb in vivo and also in vitro. The kinetics of neutrophil protein production also correlated with a more activated state. LLLT may be a safe and non-invasive approach to deal with PCM infection.
Resumo:
In this work, we discuss the use of multi-way principal component analysis combined with comprehensive two-dimensional gas chromatography to study the volatile metabolites of the saprophytic fungus Memnoniella sp. isolated in vivo by headspace solid-phase microextraction. This fungus has been identified as having the ability to induce plant resistance against pathogens, possibly through its volatile metabolites. Adequate culture media was inoculated, and its headspace was then sampled with a solid-phase microextraction fiber and chromatographed every 24 h over seven days. The raw chromatogram processing using multi-way principal component analysis allowed the determination of the inoculation period, during which the concentration of volatile metabolites was maximized, as well as the discrimination of the appropriate peaks from the complex culture media background. Several volatile metabolites not previously described in the literature on biocontrol fungi were observed, as well as sesquiterpenes and aliphatic alcohols. These results stress that, due to the complexity of multidimensional chromatographic data, multivariate tools might be mandatory even for apparently trivial tasks, such as the determination of the temporal profile of metabolite production and extinction. However, when compared with conventional gas chromatography, the complex data processing yields a considerable improvement in the information obtained from the samples. This article is protected by copyright. All rights reserved.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Informações a respeito de cultivares adaptadas ao sistema de cultivo orgânico são escassas. O objetivo deste estudo foi avaliar, sob sistema de cultivo orgânico, genótipos nacionais e estrangeiros desenvolvidos para o cultivo convencional, quanto ao potencial produtivo, em condições de campo. O experimento foi conduzido em 2008, no Pólo APTA Leste Paulista, em Monte Alegre do Sul-SP. O delineamento experimental foi em blocos ao acaso, com 18 tratamentos e quatro repetições. Cada parcela foi constituída por 80 batatas-semente, dispostas em quatro linhas de 5 m de comprimento, espaçadas de 80 cm, com 25 cm entre tubérculos. Os genótipos avaliados foram Agata, Asterix, Caesar, Cupido, Éden, Melody, Novella e Vivaldi, de origem estrangeira; e Apuã, Aracy, Catucha, IAC Aracy Ruiva, Itararé, Monte Alegre 172, IAC 6090, APTA 16.5, APTA 15.20 e APTA 21.54, nacionais. Foram avaliadas as características de produtividade total e comercial de tubérculos, massa média total e comercial de tubérculos, teor de matéria seca e severidade da pinta-preta (Alternaria solani). Os clones APTA 16.5, APTA 21.54 e IAC 6090, e as cultivares Cupido, Apuã, Itararé e Monte Alegre 172 foram os mais produtivos. 'APTA 21.54' superou os demais em relação a produtividade comercial (18,07 t ha-1), sendo que 'APTA 16.5', 'Cupido', 'IAC 6090' e 'Itararé' formaram o segundo grupo. As maiores massas médias de tubérculos foram apresentadas pelas cultivares Itararé e Cupido. O clone IAC 6090 e as cultivares Aracy e Aracy Ruiva foram as que apresentaram maiores teores de matéria seca, com valor médio de 22,91%. 'APTA 16.5', 'Apuã', 'Aracy', 'Aracy Ruiva', 'Éden', 'Ibituaçú' e 'Monte Alegre 172' apresentaram alto nível de resistência à pinta-preta. As cultivares Itararé, Apuã e Cupido são adaptadas ao cultivo orgânico, e os clones avançados APTA 16.5, APTA 21.54 e IAC 6090 apresentam potencial de cultivo no sistema orgânico.
Resumo:
A ferrugem asiática, causada pelo fungo Phakopsora pachyrhizi, apresenta-se como um dos mais graves problemas fitossanitários da cultura da soja no Brasil, principalmente por não existirem, até o presente momento, cultivares com níveis de resistência satisfatórios. Objetivou-se estudar a influência da luminosidade e da camada de cera das superfícies foliares na infecção de folhas de soja por P. pachyrhizi. A superfície adaxial ou abaxial de folíolos do primeiro trifólio de plantas da cultivar BRS 154, estádio fenológico V2, foi inoculada com suspensão de 10(5) urediniósporos/mL-1. As plantas foram mantidas por 24 horas em câmara úmida e temperatura de 23ºC, sob luz ou escuro, em delineamento fatorial. Posteriormente, permaneceram 14 dias em fotoperíodo de 12 horas, sendo em seguida avaliada a densidade de lesões e a severidade da doença. Em um segundo experimento, avaliou-se in vitro , no escuro e na luz, a porcentagem de germinação de urediniósporos e de formação de apressórios. As camadas de cera adaxial e abaxial dos folíolos foram analisadas quantitativamente (extrações com clorofórmio) e estruturalmente (microscopia eletrônica de varredura). A densidade de lesões e a severidade foram maiores quando se inoculou a superfície adaxial de plantas incubadas no escuro, sem interação significativa entre os fatores. A germinação dos esporos no escuro (40,7%) foi significativamente superior à germinação na luz (28,5%). O mesmo ocorreu para a formação de apressórios, no escuro (24,7%) e na luz (12,8%). A quantidade e a estrutura das ceras epicuticulares não apresentaram diferenças entre as duas superfícies.
Resumo:
Extracts obtained from 57 marine-derived fungal strains were analyzed by HPLC-PDA, TLC and ¹H NMR. The analyses showed that the growth conditions affected the chemical profile of crude extracts. Furthermore, the majority of fungal strains which produced either bioactive of chemically distinctive crude extracts have been isolated from sediments or marine algae. The chemical investigation of the antimycobacterial and cytotoxic crude extract obtained from two strains of the fungus Beauveria felina have yielded cyclodepsipeptides related to destruxins. The present approach constitutes a valuable tool for the selection of fungal strains that produce chemically interesting or biologically active secondary metabolites.
Resumo:
Paracoccidioides brasiliensis causes paracoccidioidomycosis (PCM) that is one of the most prevalent systemic human mycoses in Latin America. Armadillos show a high incidence of PCM infection and could, therefore, be a natural reservoir for this fungus. In this study were compared the virulence profiles of isolates obtained from nine-banded armadillos (Dasypus novemcinctus) (PbT1 and PbT4) and isolates from PCM patients (Pb265 and Bt83). Pathogenicity was evaluated by fungal load and analysis of colony morphology. Immunity against the fungus was tested by delayed type hypersensitivity test (DTH) and antibody quantification by ELISA. The higher virulence of PbT1 and PbT4 was suggested by higher fungal load in spleen and lungs. Armadillo isolates and Bt83 presented a cotton-like surface contrasting with the cerebriform appearance of Pb265. All isolates induced cellular and humoral immune responses in infected BALB/c mice. DTH reactions were similarly induced by the four isolates, however, a great variability was observed in specific antibody levels, being the highest ones induced by Bt83 and PbT4. The present work confirms that armadillos harbor P. brasiliensis, whose multiplication and induced immunity in experimentally infected mice are heterogeneous, resembling the behavior of isolates from human PCM. This study reinforces the possibility that armadillos play an important role in the biological cycle of this pathogen.
Resumo:
In this work, different reactions in vitro between an environmental bacterial isolate and fungal species were related. The Gram-positive bacteria had terminal and subterminal endospores, presented metabolic characteristics of mesophilic and acidophilic growth, halotolerance, positive to nitrate reduction and enzyme production, as caseinase and catalase. The analysis of partial sequences containing 400 to 700 bases of the 16S ribosomal RNA gene showed identity with the genus Bacillus. However, its identity as B. subtilis was confirmed after analyses of the rpoB, gyrA, and 16S rRNA near-full-length sequences. Strong inhibitory activity of environmental microorganisms, such as Penicillium sp, Aspergillus flavus, A. niger, and phytopathogens, such as Colletotrichum sp, Alternaria alternata, Fusarium solani and F. oxysporum f.sp vasinfectum, was shown on co-cultures with B. subtilis strain, particularly on Sabouraud dextrose agar (SDA) and DNase media. Red and red-ochre color pigments, probably phaeomelanins, were secreted by A. alternata and A. niger respectively after seven days of co-culture.