Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Pirellulosomes: A new type of membrane-bounded cell compartment in planctomycete bacteria of the genus Pirellula

A distinct type of cellular organization was found in two species of the planctomycete genus Pirellula, Pirellula marina and Pirellula staleyi. Both species possess two distinct regions within the cell which are separated by a single membrane. The major region of the cell, the pirellulosome, contains the fibrillar condensed nucleoid. The other area, the polar cap region, forms a continuous layer surrounding the entire pirellulosome and displays a cap of asymmetrically distributed material at one cell pole. Immuno- and cytochemical-labelling of P. marina demonstrated that DNA is located exclusively within the pirellulosome; cell RNA is concentrated in the pirellulosome, with some RNA also located in the polar cap region.

Numerical and experimental study of a homogenizer impinging jet

High-pressure homogenization is a key unit operation used to disrupt cells containing intracellular bioproducts. Modeling and optimization of this unit are restrained by a lack of information on the flow conditions within a homogenizer value. A numerical investigation of the impinging radial jet within a homogenizer value is presented. Results for a laminar and turbulent (k-epsilon turbulent model) jet are obtained using the PHOENICS finite-volume code. Experimental measurement of the stagnation region width and correlation of the cell disruption efficiency with jet stagnation pressure both indicate that the impinging jet in the homogenizer system examined is likely to be laminar under normal operating conditions. Correlation of disruption data with laminar stagnation pressure provides a better description of experimental variability than existing correlations using total pressure drop or the grouping 1/Y(2)h(2).

Neutrophils recruitment during sepsis: Critical points and crossroads

The mechanisms that initiate an inflammatory systemic response to a bacterial infection lead to a high mortality and constitute the first cause of death in Critical Care Units (ICU`s). Sepsis is a poorly understood disease and despite life support techniques and the administration of antibiotics, not much more can be done to improve its diagnosis and treatment. The present article has as main objective to discuss the role of neutrophils recruitment in sepsis, dissecting the molecular mechanisms implicated in this complex process and its importance to the pathogenesis of this outstanding cause of death.

Long-term administration of IgG2a anti-NK1.1 monoclonal antibody ameliorates lupus-like disease in NZB/W mice in spite of an early worsening induced by an IgG2a-dependent BAFF/BLyS production

The role of natural killer (NK) T cells in the development of lupus-like disease in mice is still controversial. We treated NZB/W mice with anti-NK1.1 monoclonal antibodies (mAbs) and our results revealed that administration of either an irrelevant immunoglobulin G2a (IgG2a) mAb or an IgG2a anti-NK1.1 mAb increased the production of anti-dsDNA antibodies in young NZB/W mice. However, the continuous administration of an anti-NK1.1 mAb protected aged NZB/W mice from glomerular injury, leading to prolonged survival and stabilization of the proteinuria. Conversely, the administration of the control IgG2a mAb led to an aggravation of the lupus-like disease. Augmented titres of anti-dsDNA in NZB/W mice, upon IgG2a administration, correlated with the production of BAFF/BLyS by dendritic, B and T cells. Treatment with an anti-NK1.1 mAb reduced the levels of interleukin-16, produced by T cells, in spleen cell culture supernatants from aged NZB/W. Adoptive transfer of NK T cells from aged to young NZB/W accelerated the production of anti-dsDNA in recipient NZB/W mice, suggesting that NK T cells from aged NZB/W are endowed with a B-cell helper activity. In vitro studies, using purified NK T cells from aged NZB/W, showed that these cells provided helper B-cell activity for the production of anti-dsDNA. We concluded that NK T cells are involved in the progression of lupus-like disease in mature NZB/W mice and that immunoglobulin of the IgG2a isotype has an enhancing effect on antibody synthesis due to the induction of BAFF/BLyS, and therefore have a deleterious effect in the NZB/W mouse physiology.

Two estimates concerning asymptotics of the minimizations of a Ginzburg-Landau functional

We prove two asymptotical estimates for minimizers of a Ginzburg-Landau functional of the form integral(Omega) [1/2 \del u\(2) + 1/4 epsilon(2) (1 - \u\(2))(2) W (x)] dx.

Strategies for genetic model specification in the screening of genome-wide meta-analysis signals for further replication

Background Meta-analysis is increasingly being employed as a screening procedure in large-scale association studies to select promising variants for follow-up studies. However, standard methods for meta-analysis require the assumption of an underlying genetic model, which is typically unknown a priori. This drawback can introduce model misspecifications, causing power to be suboptimal, or the evaluation of multiple genetic models, which augments the number of false-positive associations, ultimately leading to waste of resources with fruitless replication studies. We used simulated meta-analyses of large genetic association studies to investigate naive strategies of genetic model specification to optimize screenings of genome-wide meta-analysis signals for further replication. Methods Different methods, meta-analytical models and strategies were compared in terms of power and type-I error. Simulations were carried out for a binary trait in a wide range of true genetic models, genome-wide thresholds, minor allele frequencies (MAFs), odds ratios and between-study heterogeneity (tau(2)). Results Among the investigated strategies, a simple Bonferroni-corrected approach that fits both multiplicative and recessive models was found to be optimal in most examined scenarios, reducing the likelihood of false discoveries and enhancing power in scenarios with small MAFs either in the presence or in absence of heterogeneity. Nonetheless, this strategy is sensitive to tau(2) whenever the susceptibility allele is common (MAF epsilon 30%), resulting in an increased number of false-positive associations compared with an analysis that considers only the multiplicative model. Conclusion Invoking a simple Bonferroni adjustment and testing for both multiplicative and recessive models is fast and an optimal strategy in large meta-analysis-based screenings. However, care must be taken when examined variants are common, where specification of a multiplicative model alone may be preferable.

Conventional Versus Biventricular Pacing in Heart Failure and Bradyarrhythmia: The COMBAT Study

Background: Worsening in clinical and cardiac status has been noted after chronic right ventricular pacing, but it is uncertain whether atriobiventricular (BiVP) is preferable to atrio-right ventricular pacing (RVP). Conventional versus Multisite Pacing for BradyArrhythmia Therapy study (COMBAT) sought to compare BiVP versus RVP in patients with symptomatic heart failure (HF) and atrioventricular (AV) block. Methods and Results: COMBAT is a prospective multicenter randomized double blind crossover study. Patients with New York Heart Association functional class (FC) II-IV, left ventricular ejection fraction (LVEF) <40%, and AV block as an indication for pacing were enrolled. All patients underwent biventricular system implantation and then were randomized to receive successively (group A) RVP-BiVP-RVP, or (group B) BiVP-RVP-BiVP. At the end of each 3-month crossover period, patients were evaluated according to Quality of Life (QoL), FC, echocardiographic parameters, 6-Minute Walk Test (6MWT), and peak oxygen consumption (VO(2max)). Sixty patients were enrolled, and the mean follow-up period was 17.5 +/- 10.7 months. There were significant improvements in QoL, FC, LVEF, and left ventricular end-systolic volume with BiVP compared with RVP. The effects of pacing mode on 6MWT and VO(2max) were not significantly different. Death occurred more frequently with RVP. Conclusion: In patients with systolic HF and AV block requiring permanent ventricular pacing, BiVP is superior to RVP and should be considered the preferred pacing mode. (J Cardiac Fail 2010;16:293-300)

Quantification of Regional Left and Right Ventricular Deformation Indices in Healthy Neonates by Using Strain Rate and Strain Imaging

Background: Color Doppler myocardial imaging (CDMI) allows the calculation of local longitudinal or radial strain rate (SR) and strain (epsilon). The aims of this study were to determine the feasibility and reproducibility of longitudinal and radial SR and epsilon in neonates during the first hours of life and to establish reference values. Methods: Data were obtained from 55 healthy neonates (29 male; mean age, 20 +/- 14 hours; mean birth weight, 3,174 +/- 374 g). Apical and parasternal views quantified regional longitudinal and radial SR and epsilon in differing ventricular wall segments. Values at peak systole, early diastole, and late diastole were calculated from the extracted curves. CDMI data acquired at 300 +/- 50 frames/s were analyzed offline. Three consecutive cardiac cycles were measured during normal respiration. The timing of specific systolic or diastolic regional events was determined. Multiple comparisons between walls and segments were made. Results: Left ventricular (LV) longitudinal deformation showed basal differences compared with apical segments within one specific wall. Right ventricular (RV) longitudinal deformation was not homogeneous, with significant differences between basal and apical segments. Longitudinal 3 values were higher in the RV free basal and middle wall segments compared with the left ventricle. In the RV free wall apical segment, longitudinal SR and 3 were maximal. LV systolic SR and epsilon values were higher radially compared with longitudinally (radial peak systolic SR midportion, 2.9 +/- 0.6 s(-1); radial peak systolic epsilon 53.8 +/- 19%; longitudinal peak systolic SR midportion, -1.8 +/- 0.5 s(-1); longitudinal peak systolic epsilon, -24.8 +/- 3%; P < .01). Longitudinal systolic epsilon and SR interobserver variability values were 1.2% and 0.7%, respectively. Conclusion: Ultrasound-based SR and 3 imaging is a practical and reproducible clinical technique in neonates, allowing the calculation of regional longitudinal and radial deformation in RV and LV segments. These regional SR and epsilon indices represent new, noninvasive parameters that can quantify normal neonate regional cardiac function. Independent from visual interpretation, they can be used as reference values for diagnosis in ill neonates. (J Am Soc Echocardiogr 2009;22:369-375.)

Galectin-3 plays a modulatory role in the life span and activation of murine neutrophils during early Toxoplasma gondii infection

Galectins are beta-galactoside-binding lectins involved in several biological processes and galectin-3 (Gal-3) is related to modulation of immune and inflammatory responses. This study aimed to evaluate the role of Gal-3 in the life span and biological functions of murine neutrophils during in vitro infection by virulent Toxoplasma gondii RH strain. Inflammatory peritoneal neutrophils (N phi) from C57BL/6 wildtype (WT) and Gal-3 knockout (KO) mice were cultured in the presence or absence of parasites and analyzed for phosphatidylserine (PS) exposure and cell death using Annexin-V and propidium iodide staining, and cell viability by MU assay. Cell toxicities determined by lactate dehydrogenase (LDH), degranulation by lysozyme release, and cytokine production were measured in NO culture supernatants. Phorbol myristate acetate (PMA)- or zymosan-dependent reactive oxygen species (ROS) were measured in N phi cultures. Our results demonstrated that Gal-3 is involved in the increase of the viable Not. number and the decrease of PS exposure and cell death following T. gondii infection. We also observed that Gal-3 downmodulates gondii-induced N phi toxicity as well as N phi degranulation regardless of infection. Furthermore, Gal-3 expression by N phi was associated with increased levels of IL-10 in the beginning and decreased levels of TNF-alpha later on, regardless of parasite infection, as well as with decreased levels of IL-6 and increased IL-12 levels, following early parasite infection. Our results also showed that Gal-3 suppresses PMA- but not zymosan-induced ROS generation in N phi following T. gondii infection. In conclusion, Gal-3 plays an important modulatory role by interfering in N phi life span and activation during early T gondii infection. (C) 2009 Elsevier GmbH. All rights reserved.

Magnetic characterization by SQUID and FMR of a biocompatible ferrofluid based on Fe(3)O(4)

Biocompatible superparamagnetic iron oxide nanoparticles of magnetite coated with dextran were magnetically characterized using the techniques of SQUID (superconducting quantum interference device) magnetometry and ferromagnetic resonance (FMR). The SQUID magnetometry characterization was performed by isothermal measurements under applied magnetic field using the methods of zero-field-cooling (ZFC) and field-cooling (FC). The magnetic behavior of the nanoparticles indicated their superparamagnetic nature and it was assumed that they consisted exclusively of monodomains. The transition to a blocked state was observed at the temperature T(B) = (43 +/- 1) K for frozen ferrofluid and at (52 +/- 1) K for the lyophilized ferrofluid samples. The FMR analysis showed that the derivative peak-to-peak linewidth (Delta H(PP)), gyromagnetic factor (g), number of spins (N(S)), and spin-spin relaxation time (T(2)) were strongly dependent on both temperature and super-exchange interaction. This information is important for possible nanotechnological applications, mainly those which are strongly dependent on the magnetic parameters.

Lack of galectin-3 alters the balance of innate immune cytokines and confers resistance to Rhodococcus equi infection

Galectin-3 is a p-galactoside-binding lectin implicated in the fine-tuning of innate immunity. Rhodococcus equi, a facultative intracellular bacterium of macrophages, causes severe granulomatous bronchopneumonia in young horses and immunocompromised humans. The aim of this study is to investigate the role of galectin-3 in the innate resistance mechanism against R. equi infection. The bacterial challenge of galectin-3-deficient mice (gal3(-/-)) and their wild-type counterpart (gal3(+/+)) revealed that the LD50 for the gal3(-/-) mice was about seven times higher than that for the gal3(+/+) mice. When challenged with a sublethal dose, gal3(-/-) mice showed lower bacteria counts and higher production of IL-12 and IFN-gamma production, besides exhibiting a delayed although increased inflammatory reaction. Gal3(-/-) macrophages exhibited a decreased frequency of bacterial replication and survival, and higher transcript levels of IL-1 beta, IL-6, IL-10, TLR2 and MyD88. R. equi-infected gal3(+/+) macrophages showed decreased expression of TLR2, whereas R. equi-infected gal3(-/-) macrophages showed enhanced expression of this receptor. Furthermore, galectin-3 deficiency in macrophages may be responsible for the higher IL-1 beta serum levels detected in infected gal3(-/-) mice. Therefore galectin-3 may exert a regulatory role in innate immunity by diminishing IL-1 beta production and thus affecting resistance to R. equi infection.

Polymorphisms of APOE and LRP genes in Brazilian individuals with Alzheimer disease

Alzheimer disease (AD) is the most frequent cause of dementia in Western countries. Putative genetic risk factors for AD are polymorphisms in the apolipoprotein E (APOE) gene and in the low-density lipoprotein receptor-related protein (LRP) gene. Our objective was to investigate the role of the APOE coding region polymorphisms epsilon 2, epsilon 3, and epsilon 4 and APOE promoter variants A/T at position -491 and G/T at -219, as well as LRP polymorphism C/T, as risk factors for AD in Brazilian individuals. One hundred and twenty patients with probable AD, along with 120 controls were analyzed. A significant difference between patients and controls for 64 alleles was observed: frequency of this allele in AD was 0.31, and 0.10 in controls. Individuals with 2 FA alleles had a higher risk for AD than subjects with only 1 such allele; presence of 1 epsilon 2 allele proved protective. The presence of the T allele of the -219 polymorphism was also associated with an increased risk of AD, but this polymorphism is in linkage disequilibrium with APOE F polymorphisms. No significant differences between patients and controls were observed for -491 APOE or LRP polymorphisms. In this Brazilian population, both the epsilon 4 allele and T -219 polymorphism were associated with an increased risk for AD.

Eosinophils in bronchial mucosa of asthmatics after allergen challenge: effect of anti-IgE treatment

Anti-IgE, omalizumab, inhibits the allergen response in patients with asthma. This has not been directly related to changes in inflammatory conditions. We hypothesized that anti-IgE exerts its effects by reducing airway inflammation. To that end, the effect of anti-IgE on allergen-induced inflammation in bronchial biopsies in 25 patients with asthma was investigated in a randomized, double-blind, placebo-controlled study. Allergen challenge followed by a bronchoscopy at 24 h was performed at baseline and after 12 weeks of treatment with anti-IgE or placebo. Provocative concentration that causes a 20% fall in forced expiratory volume in 1 s (PC(20)) methacholine and induced sputum was performed at baseline, 8 and 12 weeks of treatment. Changes in the early and late responses to allergen, PC(20), inflammatory cells in biopsies and sputum were assessed. Both the early and late asthmatic responses were suppressed to 15.3% and 4.7% following anti-IgE treatment as compared with placebo (P < 0.002). This was paralleled by a decrease in eosinophil counts in sputum (4-0.5%) and postallergen biopsies (15-2 cells/0.1 mm(2)) (P < 0.03). Furthermore, biopsy IgE+ cells were significantly reduced between both the groups, whereas high-affinity IgE receptor and CD4+ cells were decreased within the anti-IgE group. There were no significant differences for PC(20) methacholine. The response to inhaled allergen in asthma is diminished by anti-IgE, which in bronchial mucosa is paralleled by a reduction in eosinophils and a decline in IgE-bearing cells postallergen without changing PC(20) methacholine. This suggests that the benefits of anti-IgE in asthma may be explained by a decrease in eosinophilic inflammation and IgE-bearing cells.

APOE polymorphism is associated with lipid profile, but not with arterial stiffness in the general population

Background: Cardiovascular diseases (CVD) are the main cause of death and disability in developed countries. In most cases, the progress of CVD is influenced by environmental factors and multifactorial inheritance. The purpose of this study was to investigate the association between APOE genotypes, cardiovascular risk factors, and a noninvasive measure of arterial stiffness in the Brazilian population. Methods: A total of 1493 urban Brazilian individuals were randomly selected from the general population of the Vitoria City Metropolitan area. Genetic analysis of the APOE polymorphism was conducted by PCR-RFLP and pulse wave velocity analyzed with a noninvasive automatic device. Results: Age, gender, body mass index, triglycerides, creatinine, uric acid, blood glucose, blood pressure phenotypes were no different between epsilon 2, epsilon 3 and epsilon 4 alleles. The epsilon 4 allele was associated with higher total-cholesterol (p < 0.001), LDL-C (p < 0.001), total-cholesterol/HDL-C ratio (p < 0.001), LDL/HDL-C ratio (p < 0.001), lower HDL-C values (p < 0.001) and higher risk to obesity (OR = 1.358, 95% CI = 1.019-1.811) and hyperuricemia (OR = 1.748, 95% CI = 1.170-2.611). Nevertheless, pulse wave velocity (p = 0.66) measures were no different between genotypes. The significant association between APOE genotypes and lipid levels persisted after a 5-year follow-up interval, but no interaction between time and genotype was observed for lipids longitudinal behavior. Conclusion: The epsilon 4 allele of the APOE gene is associated with a worse lipid profile in the Brazilian urban population. In our relatively young sample, the observed effect of APOE genotype on lipid levels was not translated into significant effects in arterial wall stiffness.