935 resultados para reverse logistic
Resumo:
This study sought to identify factors involved in access to the services of a basic health unit. It is a cross-sectional, population-based study involving 101 randomly-selected families residing in the area covered by the health unit. An adult resident of each household was interviewed. The response variable was whether or not the resident frequented the health unit if he/she or anyone in the family required assistance to resolve a health issue. The independent variables investigated were service provision aspects, demographic and socio-economic characteristics, individual habits, morbidities and use of the health unit. In addition to descriptive and univariate analysis, logistic regression was applied in the multivariate analysis. The results show that access to the basic health unit is associated with the treatment received previously (OR = 3,224) with accessibility (OR = 0,146) and micro-area of residence (OR = 10,918). These findings suggest that access is related to the impressions created by the care received at the health unit and is based on experiences with the service, but can also be strongly modulated by individual aspects and factors related to the territory.
Resumo:
The role of key cell cycle regulation genes such as, CDKN1B, CDKN2A, CDKN2B, and CDKN2C in sporadic medullary thyroid carcinoma (s-MTC) is still largely unknown. In order to evaluate the influence of inherited polymorphisms of these genes on the pathogenesis of s-MTC, we used TaqMan SNP genotyping to examine 45 s-MTC patients carefully matched with 98 controls. A multivariate logistic regression analysis demonstrated that CDKN1B and CDKN2A genes were related to s-MTC susceptibility. The rs2066827*GT+GG CDKN1B genotype was more frequent in s-MTC patients (62.22%) than in controls (40.21%), increasing the susceptibility to s-MTC (OR=2.47; 95% CI=1.048-5.833; P=0.038). By contrast, the rs11515*CG+GG of CDKN2A gene was more frequent in the controls (32.65%) than in patients (15.56%), reducing the risk for s-MTC (OR=0.174; 95% CI=0.048-0.627; P=0.0075). A stepwise regression analysis indicated that two genotypes together could explain 11% of the total s-MTC risk. In addition, a relationship was found between disease progression and the presence of alterations in the CDKN1A (rs1801270), CDKN2C (rs12885), and CDKN2B (rs1063192) genes. WT rs1801270 CDKN1A patients presented extrathyroidal tumor extension more frequently (92%) than polymorphic CDKN1A rs1801270 patients (50%; P=0.0376). Patients with the WT CDKN2C gene (rs12885) presented larger tumors (2.9±1.8 cm) than polymorphic patients (1.5±0.7 cm; P=0.0324). On the other hand, patients with the polymorphic CDKN2B gene (rs1063192) presented distant metastases (36.3%; P=0.0261). In summary, we demonstrated that CDKN1B and CDKN2A genes are associated with susceptibility, whereas the inherited genetic profile of CDKN1A, CDKN2B, and CDKN2C is associated with aggressive features of tumors. This study suggests that profiling cell cycle genes may help define the risk and characterize s-MTC aggressiveness.
Resumo:
to analyze the factors associated with the underreporting on the part of nurses within Primary Health Care of abuse against children and adolescents. cross-sectional study with 616 nurses. A questionnaire addressed socio-demographic data, profession, instrumentation and knowledge on the topic, identification and reporting of abuse cases. Bivariate and multivariate logistic regression was used. female nurses, aged between 21 and 32 years old, not married, with five or more years since graduation, with graduate studies, and working for five or more years in PHC predominated. The final regression model showed that factors such as working for five or more years, having a reporting form within the PHC unit, and believing that reporting within Primary Health Care is an advantage, facilitate reporting. the study's results may, in addition to sensitizing nurses, support management professionals in establishing strategies intended to produce compliance with reporting as a legal device that ensures the rights of children and adolescents.
Resumo:
The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).
Resumo:
Dulce de leche samples available in the Brazilian market were submitted to sensory profiling by quantitative descriptive analysis and acceptance test, as well sensory evaluation using the just-about-right scale and purchase intent. External preference mapping and the ideal sensory characteristics of dulce de leche were determined. The results were also evaluated by principal component analysis, hierarchical cluster analysis, partial least squares regression, artificial neural networks, and logistic regression. Overall, significant product acceptance was related to intermediate scores of the sensory attributes in the descriptive test, and this trend was observed even after consumer segmentation. The results obtained by sensometric techniques showed that optimizing an ideal dulce de leche from the sensory standpoint is a multidimensional process, with necessary adjustments on the appearance, aroma, taste, and texture attributes of the product for better consumer acceptance and purchase. The optimum dulce de leche was characterized by high scores for the attributes sweet taste, caramel taste, brightness, color, and caramel aroma in accordance with the preference mapping findings. In industrial terms, this means changing the parameters used in the thermal treatment and quantitative changes in the ingredients used in formulations.
Resumo:
Hypertension is the most prevalent and significant modifiable risk factor for coronary heart disease. A portion of patients with uncontrolled hypertension are considered to have resistant hypertension (RHTN). Myocardial ischemia incidence increases along with blood pressure (BP) levels. However, the prevalence of myocardial ischemia in patients with RHTN, as well as the factors associated with it, is unknown. We enrolled 129 patients with true RHTN regularly followed in our specialty hypertension clinic and evaluated then by resting and dipyridamole pharmacological stress myocardial perfusion scintigraphy. Patients were then divided into 2 groups: those with (I-RHTN; n = 36) and those without (NI-RHTN; n = 93) myocardial ischemia. Echocardiography, 24-hour ambulatory BP monitoring (ABPM), and flow mediated dilation (FMD) were also evaluated. Thirty six (28%) patients had myocardial ischemia. There was no difference between groups regarding age, sex, biochemical parameters, office, and 24-hour ABPM levels. Patients in the I-RHTN group were more likely diabetic (31% vs. 11%; P < 0.05) and obese (75% vs. 40%; P < 0.001). Adjusting for age and body mass index, multiple logistic regression showed that diabetes (odds ratio (OR) = 6.5; 95% confidence interval (CI) = 1.06-40.14; P = 0.04), FMD (OR = 0.18; 95% CI = 0.07-0.41; P < 0.001), heart rate (OR = 1.23; 95% CI = 1.11-1.36; P < 0.001), left ventricular mass index (OR = 1.02; 95% CI = 1.01-1.04; P = 0.04), and microalbuminuria (OR = 1.02; 95% CI = 1.01-1.04; P = 0.002) were independent predictors of ischemia. In conclusion, there is a high prevalence of myocardial ischemia in patients with RHTN. Increased microalbuminuria, heart rate, endothelial dysfunction, and left ventricular mass can be useful to guide the investigation for myocardial ischemia in these high risk patients.
Resumo:
The local anesthetic effects on neuromuscular junction and its influence on blockade produced by nondepolarizing neuromuscular blockers are still under-investigated; however, this interaction has been described in experimental studies and in humans. The aim of this study was to evaluate in vitro the interaction between ropivacaine and pancuronium, the influence on transmission and neuromuscular blockade, and the effectiveness of neostigmine and 4-aminopyridine to reverse the blockade. Rats were divided into groups (n=5) according to the study drug: ropivacaine (5μgmL(-1)); pancuronium (2μg.mL(-1)); ropivacaine+pancuronium. Neostigmine and 4-aminopyridine were used at concentrations of 2μgmL(-1) and 20μgmL(-1), respectively. The effects of ropivacaine on membrane potential and miniature end-plate potential, the amplitude of diaphragm responses before and 60minutes after the addition of ropivacaine (degree of neuromuscular blockade with pancuronium and with the association of pancuronium-ropivacaine), and the effectiveness of neostigmine and 4-aminopyridine on neuromuscular block reversal were evaluated. Ropivacaine did not alter the amplitude of muscle response (the membrane potential), but decreased the frequency and amplitude of the miniature end-plate potential. Pancuronium blockade was potentiated by ropivacaine, and partially and fully reversed by neostigmine and 4-aminopyridine, respectively. Ropivacaine increased the neuromuscular block produced by pancuronium. The complete antagonism with 4-aminopyridine suggests presynaptic action of ropivacaine.
Resumo:
To compare the hemodynamic changes following two different lipid emulsion therapies after bupivacaine intoxication in swines. Large White pigs were anesthetized with thiopental, tracheal intubation performed and mechanical ventilation instituted. Hemodynamic variables were recorded with invasive pressure monitoring and pulmonary artery catheterization (Swan-Ganz catheter). After a 30-minute resting period, 5 mg.kg-1 of bupivacaine by intravenous injection was administered and new hemodynamic measures were performed 1 minute later; the animals were than randomly divided into three groups and received 4 ml.kg-1 of one of the two different lipid emulsion with standard long-chaim triglyceride, or mixture of long and medium-chain triglyceride, or saline solution. Hemodynamic changes were then re-evaluated at 5, 10, 15, 20 and 30 minutes. Bupivacaine intoxication caused fall in arterial blood pressure, cardiac index, ventricular systolic work index mainly and no important changes in vascular resistances. Both emulsion improved arterial blood pressure mainly increasing vascular resistance since the cardiac index had no significant improvement. On the systemic circulation the hemodynamic results were similar with both lipid emulsions. Both lipid emulsions were efficient and similar options to reverse hypotension in cases of bupivacaine toxicity.
Resumo:
G-quadruplexes are secondary structures present in DNA and RNA molecules, which are formed by stacking of G-quartets (i.e., interaction of four guanines (G-tracts) bounded by Hoogsteen hydrogen bonding). Human PAX9 intron 1 has a putative G-quadruplex-forming region located near exon 1, which is present in all known sequenced placental mammals. Using circular dichroism (CD) analysis and CD melting, we showed that these sequences are able to form highly stable quadruplex structures. Due to the proximity of the quadruplex structure to exon-intron boundary, we used a validated double-reporter splicing assay and qPCR to analyze its role on splicing efficiency. The human quadruplex was shown to have a key role on splicing efficiency of PAX9 intron 1, as a mutation that abolished quadruplex formation decreased dramatically the splicing efficiency of human PAX9 intron 1. The less stable, rat quadruplex had a less efficient splicing when compared to human sequences. Additionally, the treatment with 360A, a strong ligand that stabilizes quadruplex structures, further increased splicing efficiency of human PAX9 intron 1. Altogether, these results provide evidences that G-quadruplex structures are involved in splicing efficiency of PAX9 intron 1.
Resumo:
Lateral pterygoid muscle (LPM) plays an important role in jaw movement and has been implicated in Temporomandibular disorders (TMDs). Migraine has been described as a common symptom in patients with TMDs and may be related to muscle hyperactivity. This study aimed to compare LPM volume in individuals with and without migraine, using segmentation of the LPM in magnetic resonance (MR) imaging of the TMJ. Twenty patients with migraine and 20 volunteers without migraine underwent a clinical examination of the TMJ, according to the Research Diagnostic Criteria for TMDs. MR imaging was performed and the LPM was segmented using the ITK-SNAP 1.4.1 software, which calculates the volume of each segmented structure in voxels per cubic millimeter. The chi-squared test and the Fisher's exact test were used to relate the TMD variables obtained from the MR images and clinical examinations to the presence of migraine. Logistic binary regression was used to determine the importance of each factor for predicting the presence of a migraine headache. Patients with TMDs and migraine tended to have hypertrophy of the LPM (58.7%). In addition, abnormal mandibular movements (61.2%) and disc displacement (70.0%) were found to be the most common signs in patients with TMDs and migraine. In patients with TMDs and simultaneous migraine, the LPM tends to be hypertrophic. LPM segmentation on MR imaging may be an alternative method to study this muscle in such patients because the hypertrophic LPM is not always palpable.
Polymorphism In Lep And Lepr May Modify Leptin Levels And Represent Risk Factors For Thyroid Cancer.
Resumo:
Purpose. To understand the role of polymorphisms in the LEP (rs7799039 and rs2167270) and LEPR (rs1137101 and rs1137100) genes in DTC susceptibility and their effect on leptin levels. Methods. We studied 153 patients with DTC and 234 controls through TaqMan SNP Genotyping and ELISA, comparing these data to the clinicopathological data of patients with DTC. Results. Patients with AA genotype of rs7799039 had higher levels of serum leptin (9.22 ± 0.98 ng/mL) than those with AG genotype (10.07 ± 0.60 ng/mL; P = 0.005). Individuals with AG genotype of rs2167270 also produced higher serum leptin levels (10.05 ± 0.59 ng/mL) than the subjects with GG genotype (9.52 ± 0.79 ng/mL; P < 0.05). A multivariate logistic regression adjusted for gender, age, and BMI showed that the AG genotype of rs7799039 was an independent risk for DTC (OR, 11.689; P = 0.0183; 95% CI, 1.516-90.119). Similarly, AG and GG genotypes of rs1137101 increased the susceptibility to DTC (OR, 3.747; P = 0.027; 95% CI, 1.161-12.092 and OR, 5.437; P = 0.013; 95% CI, 1.426-20.729). Conclusions. We demonstrated that rs7799039 and rs2167270 polymorphisms modify the serum leptin concentrations in patients with DTC. Furthermore, polymorphisms rs7799039 and rs1137101 increase the risk of DTC development, although they do not correlate with tumor aggressiveness.
Resumo:
To evaluate the occurrence of severe obstetric complications associated with antepartum and intrapartum hemorrhage among women from the Brazilian Network for Surveillance of Severe Maternal Morbidity. Multicenter cross-sectional study. Twenty-seven obstetric referral units in Brazil between July 2009 and June 2010. A total of 9555 women categorized as having obstetric complications. The occurrence of potentially life-threatening conditions, maternal near miss and maternal deaths associated with antepartum and intrapartum hemorrhage was evaluated. Sociodemographic and obstetric characteristics and the use of criteria for management of severe bleeding were also assessed in these women. The prevalence ratios with their respective 95% confidence intervals adjusted for the cluster effect of the design, and multiple logistic regression analysis were performed to identify factors independently associated with the occurrence of severe maternal outcome. Antepartum and intrapartum hemorrhage occurred in only 8% (767) of women experiencing any type of obstetric complication. However, it was responsible for 18.2% (140) of maternal near miss and 10% (14) of maternal death cases. On multivariate analysis, maternal age and previous cesarean section were shown to be independently associated with an increased risk of severe maternal outcome (near miss or death). Severe maternal outcome due to antepartum and intrapartum hemorrhage was highly prevalent among Brazilian women. Certain risk factors, maternal age and previous cesarean delivery in particular, were associated with the occurrence of bleeding.
Resumo:
Chronic ethanol consumption leads to reproductive damages, since it can act directly in the tissues or indirectly, causing a hormonal imbalance. Prostate is a hormone-dependent gland and, consequently, susceptible to ethanol. The potential of testosterone therapy in the ethanol-related disorders was investigated in the prostate microenvironment. UChB rats aged 90 days were divided into 2 experimental groups (n=20): C: drinking water only and EtOH: drinking 10% (v/v) ethanol at >2 g/kg body weight/day+water. At 150 days old, 10 rats from each group received subcutaneous injections of testosterone cypionate (5 mg/kg body weight) diluted in corn oil every other day for 4 weeks, constituting T and EtOH+T, while the remaining animals received corn oil as vehicle. Animals were euthanized at 180 days old, by decapitation. Blood was collected to obtain hormone concentrations and ventral prostate was dissected and processed for light microscope and molecular analyses. Ventral prostate weight, plasma testosterone and DHT and intraprostatic testosterone concentrations were increased after testosterone treatment. Plasma estradiol level was reduced in the EtOH+T. Inflammatory foci, metaplasia and epithelial atrophy were constantly found in the prostate of EtOH and were not observed after hormonal therapy. No differences were found in the expression of AR, ERβ and DACH-1. Additionally, testosterone treatment down-regulated ERα and increased the e-cadherin and α-actinin immunoreactivities. Testosterone was able to reverse damages caused by ethanol consumption in the prostate microenvironment and becomes a possible target to be investigated to ethanol-related disorders.
Resumo:
Size distributions in woody plant populations have been used to assess their regeneration status, assuming that size structures with reverse-J shapes represent stable populations. We present an empirical approach of this issue using five woody species from the Cerrado. Considering count data for all plants of these five species over a 12-year period, we analyzed size distribution by: a) plotting frequency distributions and their adjustment to the negative exponential curve and b) calculating the Gini coefficient. To look for a relationship between size structure and future trends, we considered the size structures from the first census year. We analyzed changes in number over time and performed a simple population viability analysis, which gives the mean population growth rate, its variance and the probability of extinction in a given time period. Frequency distributions and the Gini coefficient were not able to predict future trends in population numbers. We recommend that managers should not use measures of size structure as a basis for management decisions without applying more appropriate demographic studies.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.