956 resultados para process parameter monitoring


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Wearable electronic textiles are an emerging research field playing a pivotal role among several different technological areas such as sensing, communication, clothing, health monitoring, information technology, and microsystems. The possibility to realise a fully-textile platform, endowed with various sensors directly realised with textile fibres and fabric, represents a new challenge for the entire research community. Among several high-performing materials, the intrinsically conductive poly(3,4-ethylenedioxythiophene) (PEDOT), doped with poly(styrenesulfonic acid) (PSS), or PEDOT:PSS, is one of the most representative and utilised, having an excellent chemical and thermal stability, as well as reversible doping state and high conductivity. This work relies on PEDOT:PSS combined with sensible materials to design, realise, and develop textile chemical and physical sensors. In particular, chloride concentration and pH level sensors in human sweat for continuous monitoring of the wearer's hydration status and stress level are reported. Additionally, a prototype smart bandage detecting the moisture level and pH value of a bed wound to allow the remote monitoring of the healing process of severe and chronic wounds is described. Physical sensors used to monitor the pressure distribution for rehabilitation, workplace safety, or sport tracking are also presented together with a novel fully-textile device able to measure the incident X-ray dose for medical or security applications where thin, comfortable, and flexible features are essential. Finally, a proof-of-concept for an organic-inorganic textile thermoelectric generator that harvests energy directly from body heat has been proposed. Though further efforts must be dedicated to overcome issues such as durability, washability, power consumption, and large-scale production, the novel, versatile, and widely encompassing area of electronic textiles is a promising protagonist in the upcoming technological revolution.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In recent years, composite materials have revolutionized the design of many structures. Their superior mechanical properties and light weight make composites convenient over traditional metal structures for many applications. However, composite materials are susceptible to complex and challenging to predict damage behaviors due to their anisotropy nature. Therefore, structural Health Monitoring (SHM) can be a valuable tool to assess the damage and understand the physics underneath. Distributed Optical Fiber Sensors (DOFS) can be used to monitor several types of damage in composites. However, their implementation outside academia is still unsatisfactory. One of the hindrances is the lack of a rigorous methodology for uncertainty quantification, which is essential for the performance assessment of the monitoring system. The concept of Probability of Detection (POD) must function as the guiding light in this process. However, precautions must be taken since this tool was established for Non-Destructive Evaluation (NDE) rather than Structural Health Monitoring (SHM). In addition, although DOFS have been the object of numerous studies, a well-established POD methodology for their performance assessment is still missing. This thesis aims to develop a methodology to produce POD curves for DOFS in composite materials. The problem is analyzed considering several critical points, such as the strain transfer characterizing the DOFS and the development of an experimental and model-assisted methodology to understand the parameters that affect the DOFS performance.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Quantification of dermal exposure to pesticides in rural workers, used in risk assessment, can be performed with different techniques such as patches or whole body evaluation. However, the wide variety of methods can jeopardize the process by producing disparate results, depending on the principles in sample collection. A critical review was thus performed on the main techniques for quantifying dermal exposure, calling attention to this issue and the need to establish a single methodology for quantification of dermal exposure in rural workers. Such harmonization of different techniques should help achieve safer and healthier working conditions. Techniques that can provide reliable exposure data are an essential first step towards avoiding harm to workers' health.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Split-plot design (SPD) and near-infrared chemical imaging were used to study the homogeneity of the drug paracetamol loaded in films and prepared from mixtures of the biocompatible polymers hydroxypropyl methylcellulose, polyvinylpyrrolidone, and polyethyleneglycol. The study was split into two parts: a partial least-squares (PLS) model was developed for a pixel-to-pixel quantification of the drug loaded into films. Afterwards, a SPD was developed to study the influence of the polymeric composition of films and the two process conditions related to their preparation (percentage of the drug in the formulations and curing temperature) on the homogeneity of the drug dispersed in the polymeric matrix. Chemical images of each formulation of the SPD were obtained by pixel-to-pixel predictions of the drug using the PLS model of the first part, and macropixel analyses were performed for each image to obtain the y-responses (homogeneity parameter). The design was modeled using PLS regression, allowing only the most relevant factors to remain in the final model. The interpretation of the SPD was enhanced by utilizing the orthogonal PLS algorithm, where the y-orthogonal variations in the design were separated from the y-correlated variation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Systemic lupus erythematosus is an autoimmune disease that causes many psychological repercussions that have been studied through qualitative research. These are considered relevant, since they reveal the amplitude experienced by patients. Given this importance, this study aims to map the qualitative production in this theme, derived from studies of experiences of adult patients of both genders and that had used as a tool a semi-structured interview and/or field observations, and had made use of a sampling by a saturation criterion to determine the number of participants in each study. The survey was conducted in Pubmed, Lilacs, Psycinfo e Cochrane databases, searching productions in English and Portuguese idioms published between January 2005 and June 2012. The 19 revised papers that have dealt with patients in the acute phase of the disease showed themes that were categorized into eight topics that contemplated the experienced process at various stages, from the onset of the disease, extending through the knowledge of the diagnosis and the understanding of the manifestations of the disease, drug treatment and general care, evolution and prognosis. The collected papers also point to the difficulty of understanding, of the patients, on what consists the remission phase, revealing also that this is a clinical stage underexplored by psychological studies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

20

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Process Analytical Chemistry (PAC) is an important and growing area in analytical chemistry, that has received little attention in academic centers devoted to the gathering of knowledge and to optimization of chemical processes. PAC is an area devoted to optimization and knowledge acquisition of chemical processes, to reducing costs and wastes and to making an important contribution to sustainable development. The main aim of this review is to present to the Brazilian community the development and state of the art of PAC, discussing concepts, analytical techniques currently employed in the industry and some applications.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The biodegradability of animal wastes production was evaluated through a simplified methodology that allowed the verification of the applicability of anaerobic processes. The experiments were performed in bath reactors, with granular sludge of three origins: UASB reactor treating dairy effluent, UASB reactor treating swine effluent and UASB reactor treating effluent of slaughterhouse of poultry. The experiments (1) - dairy effluent and poultry slaughterhouse non-adapted sludge; (2) -swine effluent and poultry slaughterhouse non-adapted sludge; (3) - dairy effluent and poultry slaughterhouse adapted sludge; (4) - swine effluent and poultry slaughterhouse adapted sludge; (5) - dairy effluent and dairy sludge, and (6) - swine effluent and swine sludge were performed in Incubator Shaker, at a temperature of 35 °C, under agitation at a 150 rpm, for 5 minutes, every 1 hour. A substrat:biomass relationship of 0.5 was used. Kinetic models of Monod, Zero Order, First and Second Order were tested and it was verified that the First Order model provided the best adjustment. The apparent First Order kinetic parameter (k1) was estimated for the experiments 1; 2; 3; 4; 5, and 6, as 2.51 x 10-2; 2.49 x 10-2; 1.90 x 10-2; 3.09 x 10-2; 2.54 x 10-2; 4.09 x 10-2 h-1, respectively.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Development of processing technology and equipments requires new methods and better quality of the processed product. In the continuous drying process, utilization of equipments that promotes an increment in the transfer coefficients becomes of the major interest. The use of vibrational energy has been recommended to the dispersed materials. Such method is based on the use of vibrational energy applied to disperse media. Thus, a literature review on the mass transfer and drying in vibro-fluidized beds was carried out, showing experimental results and mathematical modeling.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Behavioral adjustments may occur fast and with less cost than the physiological adaptations. Considering the social behavior is suggestive that the frequency and the intensity of aggressive interactions, the total social cohesion and the extent of vicious attitudes may be used to evaluate welfare. This research presents an analysis of the interactions between the experimental factors such as temperature, genetic and time of the day in the behavior of female broiler breeders under controlled environment in a climatic chamber in order to enhance the different reaction of the birds facing distinct environmental conditions. The results showed significant differences between the behaviors expressed by the studied genetics presenting the need of monitoring them in real-time in order to predict their welfare in commercial housing, due to the complexity of the environmental variables that interfere in the well being process. The research also concluded that the welfare evaluation of female broiler breeders needs to consider the time of the day during the observation of the behaviors.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física