Two distinct regions in 2q24.2-q24.3 associated with idiopathic epilepsy

P>Approximately 50% of all carriers of 2q21-q31 deletions present epileptic seizures. The band 2q24 constitutes the smallest commonly deleted segment in these patients, and contains the voltage-gated sodium channel genes SCN1A and SCN2A, associated with Dravet syndrome and benign familial neonatal-infantile seizures, respectively. A further putative locus involving epilepsy in the region was previously identified through disruption of the SLC4A10 gene by translocation. In the course of performing high-resolution DNA copy number analyses on syndromic mentally impaired individuals, we encountered three patients with overlapping deletions in chromosome region 2q24. Two of these patients exhibited epileptic seizures in addition to mental deficiency. The deletion in one of the epileptic patients did not include the SCN cluster, demonstrating that a less severe form of epilepsy maps to an adjacent genomic region. This second region comprises about 3 Mb and contains the candidate gene SLC4A10, providing further support for the potential role of this gene in epilepsy.

Insertion/deletion polymorphism of the angiotensin converting enzyme gene and loss of the insertion allele in aldosterone-producing adenoma

The genetic mechanisms responsible for the formation of adrenocortical adenomas which autonomously produce aldosterone are largely unknown, The adrenal renin-angiotensin system has been implicated in the pathophysiology of these tumours, Angiotensin-converting enzyme (ACE) catalyses the generation of angiotensin II, and the insertion/deletion (I/D) polymorphism of the ACE gene regulates up to 50% of plasma and cellular ACE variability in humans. We therefore examined the genotypic and allelic frequency distributions of the ACE gene I/D polymorphism in 55 patients with aldosterone-producing adenoma, APA, (angiotensin-unresponsive APA n = 28, angiotensin-responsive APA n = 27), and 80 control subjects with no family history of hypertension, We also compared the ACE gene I/D polymorphism allelic pattern in matched tumour and peripheral blood DNA in the 55 patients with APA, The frequency of the D allele was 0.518 and 0.512 and the I allele was 0.482 and 0.488 in the APA and control subjects respectively, Genotypic and allelic frequency analysis found no significant differences between the groups, Examination of the matched tumour and peripheral blood DNA samples revealed the loss of the insertion allele in four of the 25 patients who were heterozygous for the ACE I/D genotype. The I/D polymorphism of the ACE gene does not appear to contribute to the biochemical and phenotypic characteristics of APA, however, the deletion of the insertion allele of the ACE gene I/D polymorphism in 16% of aldosterone-producing adenomas may represent the loss of a tumour suppressor gene/s or other genes on chromosome 17q which may contribute to tumorigenesis in APA.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Evidence that two independent host genes influence the severity of tissue damage and susceptibility to acute pyelonephritis in murine systemic candidiasis

Tissue damage in the kidney and brain after systemic infection with Candida albicans was examined in recombinant inbred strains (AKXL) derived from AKR and C57/L progenitors. Nine of the 15 strains showed mild (C57/L-like) tissue damage. Of the remainder, two strains developed lesions comparable to the AKR parental strain, whereas four exhibited a much move severe pattern of tissue damage. This was characterized by pronounced mycelial growth in the brain, and gross oedema of the kidney, with extensive fungal colonization and marked tissue destruction. The presence of the null allele of the haemolytic complement gene (Hc) may be necessary but not sufficient, for the expression of the very severe lesions. The results were interpreted as reflecting the actions of two independent genes, which have been designated Carg1 and Carg2 (Candida albicans resistance genes 1 and 2). (C) 1997 Academic Press Limited.

Meta-analysis of the association of 4 angiotensinogen polymorphisms with essential hypertension - A role beyond M235T?

Angiotensinogen (AGT) gene polymorphisms have been linked to increased risk of hypertension, but the data remain controversial. In this study we review the most commonly investigated polymorphisms at the AGT locus (other than M235T) and provide summary estimates regarding their association with essential hypertension, while addressing heterogeneity, as well as publication biases. Data on 26 818 subjects from 46 studies for the 4 most-studied AGT variants (T174M in exon 2 and 3 promoter variants: A-6G, A-20C, and G-217A) were meta-analyzed. Statistically significant associations with hypertension were identified for the T174M ( odds ratio [OR]: 1.19; 95% CI: 1.07 to 1.33; P = 0.002) and G-217A (OR: 1.37; 95% CI: 1.17 to 1.59; P = 0.00006) polymorphisms. A dual but consistent effect was observed for the -20C allele, which was associated with a decreased risk of hypertension in populations of mixed and European ancestries (OR: 0.64; 95% CI: 0.44 to 0.92; P = 0.02 and OR: 0.77; 95% CI: 0.65 to 0.91; P = 0.003, respectively), but with a 24% increase in the odds of hypertension in Asian subjects (OR: 1.24; 95% CI: 1.04 to 1.48; P = 0.02). No association of the A-6G variant with hypertension was detected. Current studies support the notion that single variants at the AGT might modulate the risk of hypertension but indicate caution in interpreting these results because of the putative presence of publication bias and gene-environment interactions.

NKX2.5 mutations in patients with non-syndromic congenital heart disease

Background: Cardiac development is a complex and multifactorial biological process. Heterozygous mutations in the transcription factor NKX2.5 are between the first evidence of a genetic cause for congenital heart defects in human beings. In this study, we evaluated the presence and frequency of mutations in the NKX2.5 gene on 159 unrelated patients with a diverse range of non-syndromic congenital heart defects (conotruncal anomalies, septal defects, left-sided lesions, right-sided lesions, patent ductus arteriosus and Ebstein`s anomaly). Methods: The coding region of the NKX2.5 locus was amplified by polymerase chain reaction and mutational analysis was performed using denaturing high performance liquid chromatography (DHPLC) and DNA sequencing. Results: We identified two distinct mutations in the NKX2.5 coding region among the 159 (1.26%) individuals evaluated. An Arg25Cys mutation was identified in a patient with Tetralogy of Fallot. The second mutation found was an Ala42Pro in a patient with Ebstein`s anomaly. Conclusions: The association of NKX2.5 mutations is present in a small percentage of patients with non-syndromic congenital heart defects and may explain only a few cases of the disease. Screening strategies considering the identification of germ-line molecular defects in congenital heart disease are still unwarranted and should consider other genes besides NKX2.5. (C) 2008 Elsevier Ireland Ltd. All rights reserved.

Congenic strains provide evidence that four mapped loci in chromosomes 2, 4, and 16 influence hypertension in the SHR

Aneas I, Rodrigues MV, Pauletti BA, Silva GJ, Carmona R, Cardoso L, Kwitek AE, Jacob HJ, Soler JM, Krieger JE. Congenic strains provide evidence that four mapped loci in chromosomes 2, 4, and 16 influence hypertension in the SHR. Physiol Genomics 37: 52-57, 2009. First published January 6, 2009; doi: 10.1152/physiolgenomics.90299.2008. - To dissect the genetic architecture controlling blood pressure (BP) regulation in the spontaneously hypertensive rat (SHR) we derived congenic rat strains for four previously mapped BP quantitative trait loci (QTLs) in chromosomes 2, 4, and 16. Target chromosomal regions from the Brown Norway rat (BN) averaging 13 - 29 cM were introgressed by marker-assisted breeding onto the SHR genome in 12 or 13 generations. Under normal salt intake, QTLs on chromosomes 2a, 2c, and 4 were associated with significant changes in systolic BP (13, 20, and 15 mmHg, respectively), whereas the QTL on chromosome 16 had no measurable effect. On high salt intake (1% NaCl in drinking water for 2 wk), the chromosome 16 QTL had a marked impact on SBP, as did the QTLs on chromosome 2a and 2c (18, 17, and 19 mmHg, respectively), but not the QTL on chromosome 4. Thus these four QTLs affected BP phenotypes differently: 1) in the presence of high salt intake (chromosome 16), 2) only associated with normal salt intake (chromosome 4), and 3) regardless of salt intake (chromosome 2c and 2a). Moreover, salt sensitivity was abrogated in congenics SHR. BN2a and SHR. BN16. Finally, we provide evidence for the influence of genetic background on the expression of the mapped QTLs individually or as a group. Collectively, these data reveal previously unsuspected nuances of the physiological roles of each of the four mapped BP QTLs in the SHR under basal and/or salt loading conditions unforeseen by the analysis of the F2 cross.

Population structure of Phytophthora cinnamomi in South Africa

Phytophthora cinnamomi isolates collected from 1977 to 1986 and 1991 to 1993 in two regions in South Africa were analyzed using isozymes. A total of 135 isolates was analyzed for 14 enzymes representing 20 putative loci, of which four were polymorphic. This led to the identification of nine different multilocus isozyme genotypes. Both mating types of P. cinnamomi occurred commonly in the Cape region, whereas, predominantly, the A2 mating type occurred in the Mpumalanga region of South Africa. A2 mating type isolates could be resolved into seven multilocus isozyme genotypes, compared with only two multilocus isozyme genotypes for the A1 mating type isolates. Low levels of gene (0.115) and genotypic (2.4%) diversity and a low number of alleles per locus (1.43) were observed for the South African P. cinnamomi population. The genetic distance between the Cape and Mpumalanga P. cinnamomi populations was relatively low (D-m = 0.165), and no specific pattern in regional distribution of multilocus isozyme genotypes could be observed. The genetic distance between the ''old'' (isolated between 1977 and 1986) and ''new'' (isolated between 1991 and 1993) P. cinnamomi populations from the Cape was low (D-m = 0.164), indicating a stable population over time. Three of the nine multilocus isozyme genotypes were specific to the ''old'' population, and only one multilocus isozyme genotype was specific to the ''new'' population. Significant differences in allele frequencies, a high genetic distance (D-m = 0.581) between the Cape A1 and A2 mating type isolates, significant deviations from Hardy-Weinberg equilibrium, a low overall level of heterozygosity, and a high fixation index (0.71) all indicate that sexual reproduction occurs rarely, if at all, in the South African P. cinnamomi population.

Application of inter simple sequence repeat (ISSR) markers to plant genetics

Microsatellites or simple sequence repeats (SSRs) are ubiquitous in eukaryotic genomes. Single-locus SSR markers have been developed for a number of species, although there is a major bottleneck in developing SSR markers whereby flanking sequences must be known to design 5'-anchors for polymerase chain reaction (PCR) primers. Inter SSR (ISSR) fingerprinting was developed such that no sequence knowledge was required. Primers based on a repeat sequence, such as (CA)(n), can be made with a degenerate 3'-anchor, such as (CA)(8)RG or (AGC)(6)TY. The resultant PCR reaction amplifies the sequence between two SSRs, yielding a multilocus marker system useful for fingerprinting, diversity analysis and genome mapping. PCR products are radiolabelled with P-32 or P-33 via end-labelling or PCR incorporation, and separated on a polyacrylamide sequencing gel prior to autoradiographic visualisation. A typical reaction yields 20-100 bands per lane depending on the species and primer. We have used ISSR fingerprinting in a number of plant species, and report here some results on two important tropical species, sorghum and banana. Previous investigators have demonstrated that ISSR analysis usually detects a higher level of polymorphism than that detected with restriction fragment length polymorphism (RFLP) or random amplified polymorphic DNA (RAPD) analyses. Our data indicate that this is not a result of greater polymorphism genetically, but rather technical reasons related to the detection methodology used for ISSR analysis.

Cor pulmonale in a patient with Brown-Vialetto-Van Laere syndrome: A case report

Brown-Vialetto-Van Laere syndrome (BVVLS) is a rare neurological disease characterized by sensorineural hearing loss and multiple cranial nerve palsies, usually involving the VIIth and IXth to XIIth cranial nerves. We describe the clinical and pathological features of a 33-year-old woman with BVVLS. The patient developed progressive exertional dyspnea, with clinical and laboratory findings of right-sided heart failure and pulmonary hypertension. She developed status epilepticus in the setting of cardiac deterioration and respiratory infection, and died of cardiogenic and septic shock. Autopsy disclosed bilateral neuronal loss and gliosis in the inferior colliculi, locus coeruleus and facial and vestibular nuclei. Cor pulmonale is a complication of hypoventilation-induced hypoxia and hypercapnia and had not yet been reported in BVVLS. (C) 2010 Elsevier B.V. All rights reserved.

Association between a 15q25 gene variant, smoking quantity and tobacco-related cancers among 17 000 individuals

Methods We performed a detailed analysis of one 15q single nucleotide polymorphism (SNP) (rs16969968) with smoking behaviour and cancer risk in a total of 17 300 subjects from five LC studies and four upper aerodigestive tract (UADT) cancer studies. Results Subjects with one minor allele smoked on average 0.3 cigarettes per day (CPD) more, whereas subjects with the homozygous minor AA genotype smoked on average 1.2 CPD more than subjects with a GG genotype (P < 0.001). The variant was associated with heavy smoking (> 20 CPD) [odds ratio (OR) = 1.13, 95% confidence interval (CI) 0.96-1.34, P = 0.13 for heterozygotes and 1.81, 95% CI 1.39-2.35 for homozygotes, P < 0.0001]. The strong association between the variant and LC risk (OR = 1.30, 95% CI 1.23-1.38, P = 1 x 10(-18)), was virtually unchanged after adjusting for this smoking association (smoking adjusted OR = 1.27, 95% CI 1.19-1.35, P = 5 x 10(-13)). Furthermore, we found an association between the variant allele and an earlier age of LC onset (P = 0.02). The association was also noted in UADT cancers (OR = 1.08, 95% CI 1.01-1.15, P = 0.02). Genome wide association (GWA) analysis of over 300 000 SNPs on 11 219 subjects did not identify any additional variants related to smoking behaviour. Conclusions This study confirms the strong association between 15q gene variants and LC and shows an independent association with smoking quantity, as well as an association with UADT cancers.

A Sex-Specific Association between a 15q25 Variant and Upper Aerodigestive Tract Cancers

Background: Sequence variants located at 15q25 have been associated with lung cancer and propensity to smoke. We recently reported an association between rs16969968 and risk of upper aerodigestive tract (UADT) cancers (oral cavity, oropharynx, hypopharynx, larynx, and esophagus) in women (OR = 1.24, P = 0.003) with little effect in men (OR = 1.04, P = 0.35). Methods: In a coordinated genotyping study within the International Head and Neck Cancer Epidemiology (INHANCE) consortium, we have sought to replicate these findings in an additional 4,604 cases and 6,239 controls from 10 independent UADT cancer case-control studies. Results: rs16969968 was again associated with UADT cancers in women (OR = 1.21, 95% CI = 1.08-1.36, P = 0.001) and a similar lack of observed effect in men [OR = 1.02, 95% CI = 0.95-1.09, P = 0.66; P-heterogeneity (P(het)) = 0.01]. In a pooled analysis of the original and current studies, totaling 8,572 UADT cancer cases and 11,558 controls, the association was observed among females (OR = 1.22, 95% CI = 1.12-1.34, P = 7 x 10(-6)) but not males (OR = 1.02, 95% CI = 0.97-1.08, P = 0.35; P(het) = 6 x 10(-4)). There was little evidence for a sex difference in the association between this variant and cigarettes smoked per day, with male and female rs16969968 variant carriers smoking approximately the same amount more in the 11,991 ever smokers in the pooled analysis of the 14 studies (P(het) = 0.86). Conclusions: This study has confirmed a sex difference in the association between the 15q25 variant rs16969968 and UADT cancers. Impact: Further research is warranted to elucidate the mechanisms underlying these observations. Cancer Epidemiol Biomarkers Prev; 20(4); 658-64. (C) 2011 AACR.

Reticular angiomatoid ""malignant"" fibrous histiocytoma-a case report with cytogenetics and molecular genetic analyses

Angiomatoid ""malignant"" fibrous histiocytoma is a rare sarcoma of low malignant potential that occurs most commonly in the extremities of children and young adults. Herein, we present a case of angiomatoid malignant fibrous histiocytoma with unusual histologic features arising in the mediastinum of an 80-year-old man. The tumor exhibited a reticular growth pattern and myxoid stroma. The tumor cells expressed epithelial membrane antigen and desmin. Cytogenetic analysis revealed the translocation t(2;22)(q33;q12). Molecular genetic analysis confirmed the rearrangement of the EWSR1 locus and the presence of the EWSR1/CREB1 fusion. This report expands the clinicopathologic spectrum of angiomatoid malignant fibrous histiocytoma and underscores the value of integrating morphologic, immunophenotypic, and molecular findings in the identification of its unusual morphologic variants. (C) 2011 Elsevier Inc. All rights reserved.

Nonsense Mutations in FGF8 Gene Causing Different Degrees of Human Gonadotropin-Releasing Deficiency

Context: FGFR1 mutations cause isolated hypogonadotropic hypogonadism (IHH) with or without olfactory abnormalities, Kallmann syndrome, and normosmic IHH respectively. Recently, missense mutations in FGF8, a key ligand for fibroblast growth factor receptor (FGFR) 1 in the ontogenesis of GnRH, were identified in IHH patients, thus establishing FGF8 as a novel locus for human GnRH deficiency. Objective: Our objective was to analyze the clinical, hormonal, and molecular findings of two familial IHH patients due to FGF8 gene mutations. Methods and Patients: The entire coding region of the FGF8 gene was amplified and sequenced in two well-phenotyped IHH probands and their relatives. Results: Two unique heterozygous nonsense mutations in FGF8(p.R127X and p.R129X) were identified in two unrelated IHH probands, which were absent in 150 control individuals. These two mutations, mapped to the core domain of FGF8, impact all four human FGF8 isoforms, and lead to the deletion of a large portion of the protein, generating nonfunctional FGF8 ligands. The p.R127X mutation was identified in an 18-yr-old Kallmann syndrome female. Her four affected siblings with normosmic IHH or delayed puberty also carried the p.R127X mutation. Additional developmental anomalies, including cleft lip and palate and neurosensorial deafness, were also present in this family. The p.R129X mutation was identified in a 30-yr-old man with familial normosmic IHH and severe GnRH deficiency. Conclusions: We identified the first nonsense mutations in the FGF8 gene in familial IHH with variable degrees of GnRH deficiency and olfactory phenotypes, confirming that loss-of-function mutations in FGF8 cause human GnRH deficiency. (J Clin Endocrinol Metab 95: 3491-3496, 2010)

Polymorphisms in innate immunity genes and patients response to dendritic cell-based HIV immuno-treatment

Dendritic cells (DCs)-based vaccine was demonstrated to increase HIV specific cellular immune response; however, in some HIV-infected patients, the response to the vaccine resulted to be not effective. In order to understand if the outcome of the vaccination may be influenced by the host`s genome and natural immunity, we studied the innate immune genome of HIV-infected patients previously vaccinated with DCs. We identified 15 SNPs potentially associated with the response to the immuno-treatment and two SNPs significantly associated with the modulation of the response to the DC vaccine: MBL2 rs10824792 and NOS1 rs693534. These two SNPs were also studied in different ethnic groups (Brazilians, African and Caucasian) of HIV-infected, exposed uninfected and unexposed uninfected subjects. The HIV positive Caucasian patients were also characterized by different disease progressions. Our findings suggest that, independently and/or in addition to other variables. the host`s genome could significantly contribute to the modulation of the response to the DC vaccine. (C) 2009 Elsevier Ltd. All rights reserved.