Factors associated with the prevalence of hypertension and control practices among elderly residents of São Paulo city, Brazil

The aim of this study was to analyze the prevalence of hypertension and control practices among the elderly. The survey analyzed data from 872 elderly people in São Paulo, Brazil, through a cluster sampling, stratified according to education and income. A Poisson multiple regression model checked for the existence of factors associated with hypertension. The prevalence of self-reported hypertension among the elderly was 46.9%. Variables associated with hypertension were self-rated health, alcohol consumption, gender, and hospitalization in the last year, regardless of age. The three most common measures taken to control hypertension, but only rarely, are oral medication, routine salt-free diet and physical activity. Lifestyle and socioeconomic status did not affect the practice of control, but knowledge about the importance of physical activity was higher among those older people with higher education and greater income. The research suggests that health policies that focus on primary care to encourage lifestyle changes among the elderly are necessary.

Behaviour of albino and melanic variants of Biomphalaria glabrata Say, 1818 (Mollusca: Planorbidae) following infection by Schistosoma mansoni Sambon, 1907

The behaviour of the albino and melanic variants of Biomphalaria glabrata of Belo Horizonte (MG. Brazil) was studied comparatively, in terms of their respective susceptibilities to infection by Schistosoma mansoni of the same origin, through observation of the elimination of cercariae for a three-month period and the calculation of mortality and infection rates, in control and in infected snails. The number of amoebocytes, granulocytes and hyalinocytes in the circulating hemolymph during different periods of infection was analyzed. The evolution of the infection in the tissues was observed by means of histological cross-sections. The melanic variant showed greater susceptibility to infection and a higher mortality rate. The albino variant showed a higher number of circulating amoebocytes, both granulocytes and hyalinocytes. A higher number of degenerated sporocysts were seen in the histological cross-sections of the albino variant. The results suggest that the melanic variant of B. glabrata was more susceptible to infection by S. mansoni than was the albino variant.

Evaluation of the cytotoxic and genotoxic potential of water from the River Paraíba do Sul, in Brazil, with the Allium cepa L. test

This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Ciclimo de velocidade : uma proposta de controle da preparação fisica especial

Universidade Estadual de Campinas . Faculdade de Educação Física

Da preparação preliminar ao nivel olimpico : um estudo de caso no remo brasileiro feminino

Universidade Estadual de Campinas . Faculdade de Educação Física

Uma proposta de preparação para equipes jovens de voleibol feminino

Universidade Estadual de Campinas. Faculdade de Educação Física

Termo do 1º Consenso em Disfunção Temporomandibular e Dor Orofacial

O Termo do 1º Consenso em Disfunção Temporomandibular e Dor Orofacial* foi criado com o propósito de substituir divergências por evidência científica dentro dessa especialidade da Odontologia. O documento oferece informações claras e fundamentadas para orientar o cirurgião-dentista e demais profissionais de saúde sobre os cuidados demandados pelo paciente, tanto no processo de diagnóstico diferencial quanto na fase de aplicação das terapias de controle da dor e disfunção. O Termo foi aprovado no mês de janeiro de 2010 em reunião realizada durante o Congresso Internacional de Odontologia do Estado de São Paulo e converge o pensamento dos profissionais mais conceituados do Brasil na especialidade Disfunção Temporomandibular e Dor Orofacial.

T-wave alternans: desempenho clínico, limitações, metodologias de análise

Reconhecer com precisão indivíduos com maior risco imediato de morte súbita cardíaca (MSC) ainda é uma questão em aberto. A natureza fortuita dos eventos cardiovasculares agudos não parece se adequar ao conhecido modelo de indução de taquicardia/fibrilação ventricular por um gatilho em sincronia a um substrato arritmogênico estático. Quanto ao mecanismo da MSC, uma instabilidade elétrica dinâmica explicaria melhor a raridade da associação simultânea de um gatilho certo a um substrato cardíaco apropriado. Diversos estudos tentaram medir essa instabilidade elétrica cardíaca (ou um equivalente válido) em uma sequência de batimentos cardíacos no ECG. Dentre os mecanismos possíveis podemos citar o prolongamento do QT, dispersão do QT, potenciais tardios, alternância de onda T ou T-wave alternans (TWA), e turbulência da frequência cardíaca. Este artigo se atém em particular ao papel da TWA no panorama atual da estratificação de risco cardíaco. Os achados sobre TWA ainda são heterogêneos, variando de um desempenho prognóstico muito bom até um quase nulo, dependendo da população clínica observada e protocolo clínico usado. Para preencher as atuais lacunas no conhecimento sobre TWA, profissionais médicos e pesquisadores devem explorar melhor as características técnicas das diversas tecnologias disponíveis para a avaliação de TWA e atentar ao fato de que os valores de TWA respondem a diversos outros fatores, além de medicamentos. Informações sobre mecanismos celulares e subcelulares da TWA estão fora do escopo deste artigo, mas são referenciados alguns dos principais trabalhos sobre este tópico, com o intuito de auxiliar no entendimento dos conceitos e fatos cobertos neste artigo.

Control of erosive tooth wear: possibilities and rationale

Dental erosion is a type of wear caused by non bacterial acids or chelation. There is evidence of a significant increase in the prevalence of dental wear in the deciduous and permanent teeth as a consequence of the frequent intake of acidic foods and drinks, or due to gastric acid which may reach the oral cavity following reflux or vomiting episodes. The presence of acids is a prerequisite for dental erosion, but the erosive wear is complex and depends on the interaction of biological, chemical and behavioral factors. Even though erosion may be defined or described as an isolated process, in clinical situations other wear phenomena are expected to occur concomitantly, such as abrasive wear (which occurs, e.g, due to tooth brushing or mastication). In order to control dental loss due to erosive wear it is crucial to take into account its multifactorial nature, which predisposes some individuals to the condition.

Proposal for the teaching of the chemical control of supragingival biofilm

The mechanical control of supragingival biofilm is accepted as one of the most important measures to treat and prevent dental caries and periodontal diseases. Nevertheless, maintaining dental surfaces biofilm-free is not an easy task. In this regard, chemical agents, mainly in the form of mouthwashes, have been studied to help overcome the difficulties involved in the mechanical control of biofilm. The aim of this paper was to discuss proposals for the teaching of supragingival chemical control (SCC) in order to improve dentists' knowledge regarding this clinical issue. Firstly, the literature regarding the efficacy of antiseptics is presented, clearly showing that chemical agents are clinically effective in the reduction of biofilm and gingival inflammation when used as adjuvant agents to mechanical control. Thus, it is suggested that the content related to SCC be included in the curricular grid of dental schools. Secondly, some essential topics are recommended to be included in the teaching of SCC as follows: skills and competencies expected of a graduate dentist regarding SCC; how to include this content in the curricular grid; teaching-learning tools and techniques to be employed; and program content.

Uso da Classificação Internacional de Doenças na análise do absenteísmo odontológico

OBJETIVO: Comparar o uso das codificações da classificação de doenças e agravos em solicitações de afastamento do trabalho por motivo odontológico. MÉTODOS: Foram analisadas 240 solicitações emitidas em um serviço público federal entre janeiro de 2008 e dezembro de 2009. O uso da Classificação Estatística Internacional de Doenças e Problemas Relacionados à Saúde - Décima Revisão (CID-10) foi comparado ao sistema de Classificação Internacional de Doenças em Odontologia e Estomatologia (CID-OE). Foi determinada a especificidade da codificação nas solicitações de afastamento, bem como da codificação atribuída por peritos oficiais em inspeções indiretas, perícias e juntas odontológicas. RESULTADOS: Do total de atestados, 22,9% não apresentaram a CID, 7,1% apresentaram a CID-9, 3,3% a CID-OE e 66,7% a CID-10. A maioria das codificações foi concordante (55,1%), com maior especificidade nas codificações atribuídas após avaliação dos cirurgiões-dentistas peritos oficiais. CONCLUSÕES: É necessário aperfeiçoar a utilização da CID-10 entre os profissionais de Odontologia e perícia odontológica no trabalho. Sugere-se a incorporação do uso da CID-OE e da Classificação Internacional de Funcionamento, Incapacidade e Saúde para a análise dos afastamentos do trabalho, fornecendo dados relevantes para o monitoramento do absenteísmo por motivo odontológico.

Controle de temperatura em intervenção cirúrgica abdominal convencional: comparação entre os métodos de aquecimento por condução e condução associada à convecção

JUSTIFICATIVA E OBJETIVOS: Hipotermia intra-operatória é complicação frequente, favorecida por operação abdominal. A eficácia da associação dos métodos de aquecimento por condução e convecção na prevenção de hipotermia e seus efeitos no período de recuperação pós-operatória foram os objetivos deste estudo. MÉTODO: Quarenta e três pacientes de ambos os sexos de 18 a 88 anos de idade, submetidos à laparotomia xifopúbica sob anestesia geral e monitorização da temperatura esofágica, foram distribuídos de modo aleatório em dois grupos de aquecimento: COND (n = 24), com colchão de circulação de água a 37°C no dorso e COND + CONV (n = 19), com a mesma condição associada à manta de ar aquecido a 42°C sobre o tórax e membros superiores. Analisados peso, sexo, idade, duração da operação e anestesia, temperaturas na indução anestésica (Mi), horas consecutiva (M1, M2), final da operação (Mfo) e anestesia (Mfa), entrada (Me-REC) e saída (Ms-REC) da recuperação pós-anestésica (SRPA), além das incidências de tremores e queixas de frio no pós-operatório. RESULTADOS: Os grupos foram semelhantes em todas as variáveis analisadas, exceto nas temperaturas em M2, M3, M4, Mfo e Mfa. O grupo COND reduziu a temperatura a partir da segunda hora da indução anestésica, mas o grupo COND + CONV só na quarta hora. Em COND, observou-se hipotermia na entrada e saída da SRPA. CONCLUSÕES: Associar métodos de aquecimento retardou a instalação e diminui a intensidade da hipotermia intra-operatória, mas não reduziu a incidência das queixas de frio e tremores.

Central chemoreceptors and neural mechanisms of cardiorespiratory control

The arterial partial pressure (P CO2) of carbon dioxide is virtually constant because of the close match between the metabolic production of this gas and its excretion via breathing. Blood gas homeostasis does not rely solely on changes in lung ventilation, but also to a considerable extent on circulatory adjustments that regulate the transport of CO2 from its sites of production to the lungs. The neural mechanisms that coordinate circulatory and ventilatory changes to achieve blood gas homeostasis are the subject of this review. Emphasis will be placed on the control of sympathetic outflow by central chemoreceptors. High levels of CO2 exert an excitatory effect on sympathetic outflow that is mediated by specialized chemoreceptors such as the neurons located in the retrotrapezoid region. In addition, high CO2 causes an aversive awareness in conscious animals, activating wake-promoting pathways such as the noradrenergic neurons. These neuronal groups, which may also be directly activated by brain acidification, have projections that contribute to the CO2-induced rise in breathing and sympathetic outflow. However, since the level of activity of the retrotrapezoid nucleus is regulated by converging inputs from wake-promoting systems, behavior-specific inputs from higher centers and by chemical drive, the main focus of the present manuscript is to review the contribution of central chemoreceptors to the control of autonomic and respiratory mechanisms.

Cognitive control associated with irritability induction: an autobiographical recall fMRI study

OBJECTIVE: Despite the relevance of irritability emotions to the treatment, prognosis and classification of psychiatric disorders, the neurobiological basis of this emotional state has been rarely investigated to date. We assessed the brain circuitry underlying personal script-driven irritability in healthy subjects (n = 11) using functional magnetic resonance imaging. METHOD: Blood oxygen level-dependent signal changes were recorded during auditory presentation of personal scripts of irritability in contrast to scripts of happiness or neutral emotional content. Self-rated emotional measurements and skin conductance recordings were also obtained. Images were acquired using a 1,5T magnetic resonance scanner. Brain activation maps were constructed from individual images, and between-condition differences in the mean power of experimental response were identified by using cluster-wise nonparametric tests. RESULTS: Compared to neutral scripts, increased blood oxygen level-dependent signal during irritability scripts was detected in the left subgenual anterior cingulate cortex, and in the left medial, anterolateral and posterolateral dorsal prefrontal cortex (cluster-wise p-value < 0.05). While the involvement of the subgenual cingulate and dorsal anterolateral prefrontal cortices was unique to the irritability state, increased blood oxygen level-dependent signal in dorsomedial and dorsal posterolateral prefrontal regions were also present during happiness induction. CONCLUSION: Irritability induction is associated with functional changes in a limited set of brain regions previously implicated in the mediation of emotional states. Changes in prefrontal and cingulate areas may be related to effortful cognitive control aspects that gain salience during the emergence of irritability.