Oropouche Virus Infection And Pathogenesis Is Restricted By Mavs, Irf-3, Irf-7, And Type I Ifn Signaling Pathways In Non-myeloid Cells.

Oropouche virus (OROV) is a member of the Orthobunyavirus genus in the Bunyaviridae family and a prominent cause of insect-transmitted viral disease in Central and South America. Despite its clinical relevance, little is known about OROV pathogenesis. To define the host defense pathways that control OROV infection and disease, we evaluated OROV pathogenesis and immune responses in primary cells and mice that were deficient in the RIG-I-like receptor signaling pathway (MDA5, RIG-I, or MAVS), downstream regulatory transcription factors (IRF-3 or IRF-7), IFN-β, or the receptor for type I IFN signaling (IFNAR). OROV replicated to higher levels in primary fibroblasts and dendritic cells lacking MAVS signaling, the transcription factors IRF-3 and IRF-7, or IFNAR. In mice, deletion of IFNAR, MAVS, or IRF-3 and IRF-7 resulted in uncontrolled OROV replication, hypercytokinemia, extensive liver damage, and death whereas wild-type (WT) congenic animals failed to develop disease. Unexpectedly, mice with a selective deletion of IFNAR on myeloid cells (CD11c Cre(+) Ifnar(f/f) or LysM Cre(+) Ifnar(f/f)) did not sustain enhanced disease with OROV or La Crosse virus, a closely related encephalitic orthobunyavirus. In bone marrow chimera studies, recipient irradiated Ifnar(-/-) mice reconstituted with WT hematopoietic cells sustained high levels of OROV replication and liver damage, whereas WT mice reconstituted with Ifnar(-/-) bone marrow were resistant to disease. Collectively, these results establish a dominant protective role for MAVS, IRF-3 and IRF-7, and IFNAR in restricting OROV virus infection and tissue injury, and suggest that IFN signaling in non-myeloid cells contributes to the host defense against orthobunyaviruses. Oropouche virus (OROV) is an emerging arthropod-transmitted orthobunyavirus that causes episodic outbreaks of a debilitating febrile illness in humans in countries of South and Central America. The continued expansion of the range and number of its arthropod vectors increases the likelihood that OROV will spread into new regions. At present, the pathogenesis of OROV in humans or other vertebrate animals remains poorly understood. To define cellular mechanisms of control of OROV infection, we performed infection studies in a series of primary cells and mice that were deficient in key innate immune genes involved in pathogen recognition and control. Our results establish that a MAVS-dependent type I IFN signaling pathway has a dominant role in restricting OROV infection and pathogenesis in vivo.

Characterization Of A Protein-protein Interaction Network Of The Cbl-interacting Protein Kinase 8 From Sugarcane.

Plants are sessile organisms and have evolved to tolerate a constantly changing environment. After the onset of different stress conditions, calcineurin B-like (CBL) proteins can sense calcium signals and activate CBL-interacting protein kinase (CIPK) proteins, which can phosphorylate downstream proteins to reestablish plant homeostasis. Previous studies in the bioenergy crop sugarcane showed that the ScCIPK8 gene is induced by drought stress and is also related to sucrose content. Here, we have characterized the protein-protein interactions of ScCIPK8 with six CBL proteins (ScCBL1, ScCBL2, ScCBL3, ScCBL6, ScCBL9, and ScCBL10). Yeast two-hybrid assays showed that ScCIPK8 interacts with ScCBL1, ScCBL3, and ScCBL6. Bimolecular fluorescence complementation assays confirmed in planta the interactions that were observed in yeast cells. These findings give insights on the regulatory networks related to sugar accumulation and drought stress responses in sugarcane.

Bay 41-2272 Activates Host Defence Against Local And Disseminated Candida Albicans Infections.

In our previous study, we have found that 5-cyclopropyl-2-[1-(2-fluoro-benzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]-pyrimidin-4-ylamine (BAY 41-2272), a guanylate cyclase agonist, activates human monocytes and the THP-1 cell line to produce the superoxide anion, increasing in vitro microbicidal activity, suggesting that this drug can be used to modulate immune functioning in primary immunodeficiency patients. In the present work, we investigated the potential of the in vivo administration of BAY 41-2272 for the treatment of Candida albicans and Staphylococcus aureus infections introduced via intraperitoneal and subcutaneous inoculation. We found that intraperitoneal treatment with BAY 41-2272 markedly increased macrophage-dependent cell influx to the peritoneum in addition to macrophage functions, such as spreading, zymosan particle phagocytosis and nitric oxide and phorbol myristate acetate-stimulated hydrogen peroxide production. Treatment with BAY 41-2272 was highly effective in reducing the death rate due to intraperitoneal inoculation of C. albicans, but not S. aureus. However, we found that in vitro stimulation of peritoneal macrophages with BAY 41-2272 markedly increased microbicidal activities against both pathogens. Our results show that the prevention of death by the treatment of C. albicans-infected mice with BAY 41-2272 might occur primarily by the modulation of the host immune response through macrophage activation.

New Interaction Partners For Nek4.1 And Nek4.2 Isoforms: From The Dna Damage Response To Rna Splicing.

Neks are serine-threonine kinases that are similar to NIMA, a protein found in Aspergillus nidulans which is essential for cell division. In humans there are eleven Neks which are involved in different biological functions besides the cell cycle control. Nek4 is one of the largest members of the Nek family and has been related to the primary cilia formation and in DNA damage response. However, its substrates and interaction partners are still unknown. In an attempt to better understand the role of Nek4, we performed an interactomics study to find new biological processes in which Nek4 is involved. We also described a novel Nek4 isoform which lacks a region of 46 amino acids derived from an insertion of an Alu sequence and showed the interactomics profile of these two Nek4 proteins. Isoform 1 and isoform 2 of Nek4 were expressed in human cells and after an immunoprecipitation followed by mass spectrometry, 474 interacting proteins were identified for isoform 1 and 149 for isoform 2 of Nek4. About 68% of isoform 2 potential interactors (102 proteins) are common between the two Nek4 isoforms. Our results reinforce Nek4 involvement in the DNA damage response, cilia maintenance and microtubule stabilization, and raise the possibility of new functional contexts, including apoptosis signaling, stress response, translation, protein quality control and, most intriguingly, RNA splicing. We show for the first time an unexpected difference between both Nek4 isoforms in RNA splicing control. Among the interacting partners, we found important proteins such as ANT3, Whirlin, PCNA, 14-3-3ε, SRSF1, SRSF2, SRPK1 and hNRNPs proteins. This study provides new insights into Nek4 functions, identifying new interaction partners and further suggests an interesting difference between isoform 1 and isoform 2 of this kinase. Nek4 isoform 1 may have similar roles compared to other Neks and these roles are not all preserved in isoform 2. Besides, in some processes, both isoforms showed opposite effects, indicating a possible fine controlled regulation.

Interaction Between Fiscal And Monetary Policy In A Dynamic Nonlinear Model.

The objective of this study is to verify the dynamics between fiscal policy, measured by public debt, and monetary policy, measured by a reaction function of a central bank. Changes in monetary policies due to deviations from their targets always generate fiscal impacts. We examine two policy reaction functions: the first related to inflation targets and the second related to economic growth targets. We find that the condition for stable equilibrium is more restrictive in the first case than in the second. We then apply our simulation model to Brazil and United Kingdom and find that the equilibrium is unstable in the Brazilian case but stable in the UK case.

Imatinib Restores Vasp Activity And Its Interaction With Zyxin In Bcr-abl Leukemic Cells.

Vasodilator-stimulated phosphoprotein (VASP) and Zyxin are interacting proteins involved in cellular adhesion and motility. PKA phosphorylates VASP at serine 157, regulating VASP cellular functions. VASP interacts with ABL and is a substrate of the BCR-ABL oncoprotein. The presence of BCR-ABL protein drives oncogenesis in patients with chronic myeloid leukemia (CML) due to a constitutive activation of tyrosine kinase activity. However, the function of VASP and Zyxin in BCR-ABL pathway and the role of VASP in CML cells remain unknown. In vitro experiments using K562 cells showed the involvement of VASP in BCR-ABL signaling. VASP and Zyxin inhibition decreased the expression of anti-apoptotic proteins, BCL2 and BCL-XL. Imatinib induced an increase in phosphorylation at Ser157 of VASP and decreased VASP and BCR-ABL interaction. VASP did not interact with Zyxin in K562 cells; however, after Imatinib treatment, this interaction was restored. Corroborating our data, we demonstrated the absence of phosphorylation at Ser157 in VASP in the bone marrow of CML patients, in contrast to healthy donors. Phosphorylation of VASP on Ser157 was restored in Imatinib responsive patients though not in the resistant patients. Therefore, we herein identified a possible role of VASP in CML pathogenesis, through the regulation of BCR-ABL effector proteins or the absence of phosphorylation at Ser157 in VASP.

Two mistletoes are too many?: Interspecific occurrence of mistletoes on the same host tree

Mistletoe can have a major impact on the fitness of the host plant. If there is more than one species of mistletoe on the same host tree, the overall impact might be amplified. We report the occurrence of more than one species of mistletoe on the same host tree. Although it is not a rule in the field, to our knowledge, there have been no studies of this topic. In most cases, two species of mistletoe were recorded on the same host tree, although we recorded three species of mistletoe on one occasion. This demonstrates that different species of mistletoe can be compatible with the same host species. Therefore, compatibility (structural and physiological) might be an important factor for the occurrence of mistletoe. Recent studies have shown that if the mistletoe does not recognize the host species, the deposited seeds will germinate but the haustorium will not penetrate the host branch. This is probably the primary mechanism in the establishment of more than one species of mistletoe on the same host, which can trigger a cascade of harmful effects for the host species.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Interaction between staining and degradation of a composite resin in contact with colored foods

Composite resins might be susceptible to degradation and staining when in contact with some foods and drinks. This study evaluated color alteration and changes in microhardness of a microhybrid composite after immersion in different colored foods and determined whether there was a correlation between these two variables. Eighty composite disks were randomly divided into 8 experimental groups (n = 10): kept dry; deionized water; orange juice; passion fruit juice; grape juice; ketchup; mustard and soy sauce. The disks were individually immersed in their respective test substance at 37 ºC, for a period of 28 days. Superficial analysis of the disk specimens was performed by taking microhardness measurements (Vickers, 50 g load for 45 seconds) and color alterations were determined with a spectrophotometer (CINTRA 10- using a CIEL*a*b* system, 400-700 nm wavelength, illuminant d65 and standard observer of 2º) at the following times: baseline (before immersion), 1, 7, 14, 21 and 28 days. Results were analyzed by ANOVA and Tukey's test (p < 0.05). Both variables were also submitted to Pearson's correlation test (p < 0.05). The passion fruit group underwent the greatest microhardness change, while the mustard group suffered the greatest color alteration. Significant positive correlation was found between the two variables for the groups deionized water, grape juice, soy sauce and ketchup. Not all color alteration could be associated with surface degradation.

Insect feeding preferences on Piperaceae species observed in São Paulo city, Brazil

Piperaceae species have been placed among the basal angiosperm and are adapted to a variety of habitats including moist forests, secondary vegetation and dry high lands. The major anatomical/morphology features are of small trees, vines, and shrubs for Piper species, while the epiphytic and succulent characteristics are predominant forms among Peperomia species. Their secondary chemistry can be mostly represented by amides, phenylpropanoids/lignoids, and chromenes in addition to a phletoria of biosynthetically mixed-origin secondary compounds. Although several amides and lignans are known as insecticides, several phytophagous insects, among which some considered pests of economic importance, have been observed feeding vigorously on Piperaceae species. Herein we describe the feeding preferences of fourteen phytophagous species of Coleoptera, Lepidoptera and Hemiptera over approximately fifty Piperaceae species observed in São Paulo, SP, Brazil, in a long-term basis.

Alluvial-eolian interaction in a Cambrian rift margin: the Pedra das Torrinhas and Pedra Pintada formations (Guaritas Group, RS)

This work presents a study of selected outcrops from the Pedra das Torrinhas Formation of the Guaritas Group (Cambrian, Camaquã Basin), near the basin bordering Encantadas Fault Zone. The studied succession includes alluvial fan deposits that pass laterally into eolian deposits. Sedimentary facies and architectural element analysis were performed, followed by sedimentary petrography and microscopic porosity analysis, aiming to characterize the porosity of the deposits and its spatial distribution. The main objective was to contribute to a better understanding of the porosity spatial distribution in depositional systems characterized by the interaction between alluvial and eolian processes, with special reference to deposits formed prior to the development of terrestrial plants. Porosity values are related to depositional processes, with higher porosities associated to eolian dune deposits (mean of 8.4%), and lower porosity related to interdunes (mean of 3.4%) and alluvial fans (mean of 4.3%). Architectural elements analysis revealed the spatial relationships of these deposits, a response to the interplay of the eolian and alluvial processes. The integration of porosity data reveals that the interaction of alluvial and eolian processes results in heterogeneous distribution of porosity at the facies association scale. Eolian reworking of alluvial facies increases porosity whereas sheet-flood and other alluvial processes in the interdune areas reduce porosity.

Antibiosis and dark-pigments secretion by the phytopathogenic and environmental fungal species after interaction in vitro with a Bacillus subtilis isolate

In this work, different reactions in vitro between an environmental bacterial isolate and fungal species were related. The Gram-positive bacteria had terminal and subterminal endospores, presented metabolic characteristics of mesophilic and acidophilic growth, halotolerance, positive to nitrate reduction and enzyme production, as caseinase and catalase. The analysis of partial sequences containing 400 to 700 bases of the 16S ribosomal RNA gene showed identity with the genus Bacillus. However, its identity as B. subtilis was confirmed after analyses of the rpoB, gyrA, and 16S rRNA near-full-length sequences. Strong inhibitory activity of environmental microorganisms, such as Penicillium sp, Aspergillus flavus, A. niger, and phytopathogens, such as Colletotrichum sp, Alternaria alternata, Fusarium solani and F. oxysporum f.sp vasinfectum, was shown on co-cultures with B. subtilis strain, particularly on Sabouraud dextrose agar (SDA) and DNase media. Red and red-ochre color pigments, probably phaeomelanins, were secreted by A. alternata and A. niger respectively after seven days of co-culture.

Seroprevalence of Rickettsia bellii and Rickettsia felis in dogs, São José dos Pinhais, State of Paraná, Brazil

Brazilian spotted fever (BSF) is a vector-borne zoonosis caused by Rickettsia rickettsii bacteria. Dogs can be host sentinels for this bacterium. The aim of the study was to determine the presence of antibodies against Rickettsia spp. in dogs from the city of São José dos Pinhais, State of Paraná, Southern Brazil, where a human case of BSF was first reported in the state. Between February 2006 and July 2007, serum samples from 364 dogs were collected and tested at 1:64 dilutions by indirect immunofluorescence assay (IFA) against R. rickettsii and R. parkeri. All sera that reacted at least to one of Rickettsia species were tested against the six main Rickettsia species identified in Brazil: R. rickettsii, R. parkeri, R. bellii, R. rhipicephali, R. amblyommii and R. felis. Sixteen samples (4.4%) reacted to at least one Rickettsia species. Among positive animals, two dogs (15.5%) showed suggestive titers for R. bellii exposure. One sample had a homologous reaction to R. felis, a confirmed human pathogen. Although Rickettsia spp. circulation in dogs in the area studied may be considered at low prevalence, suggesting low risk of human infection, the present data demonstrate for the first time the exposure of dogs to R. bellii and R. felis in Southern Brazil.

Heartworm (Dirofilaria immitis) disease in a Brazilian oncilla (Leopardus tigrinus)

Heartworm disease is caused by the intravascular nematode Dirofilaria immitis, a pathogen of public health importance usually associated to domestic dogs and cats, and to a lesser extend to other mammal species. The oncilla (Leopardus tigrinus) is a threatened neotropic felid species that naturally occurs in Brazil. Here, we report the encounter of adult and larval stages of heartworms in a female specimen of L. tigrinus, probable of free-ranging origin, from Ubatuba, São Paulo, Brazil, which died showing clinical signals compatible with heartworm disease. This was the first reported case of D. immitis infection and associated disease in L. tigrinus, also suggesting that the oncilla acted as a definitive host for this parasite. The present findings confirmed D. immitis as a pathogenic agent for this felid species, thus supporting the recommendation for the inclusion of diagnostic testing for this pathogen in routine health screening procedures for captive and free-ranging oncillas in Brazil, especially in those localities where climate conditions support the occurrence of the parasite. Potential reservoirs as oncillas are established beyond the reach of veterinary care, thus representing a continuing risk for domestic animals and humans acquiring heartworm infection. We encourage further serologic and molecular studies aiming to establish D. immitis prevalences in L. tigrinus and other wild carnivores in the region of Ubatuba, as well as ecological and veterinary studies to access the role of this pathogen for the survival of this threatened felid species.

Cooperation, interaction and learning in local production systems: Evidence in Brazilian firms

In a local production system (LPS), besides external economies, the interaction, cooperation, and learning are indicated by the literature as complementary ways of enhancing the LPS's competitiveness and gains. In Brazil, the greater part of LPSs, mostly composed by small enterprises, displays incipient relationships and low levels of interaction and cooperation among their actors. The size of the participating enterprises itself for specificities that engender organizational constraints, which, in turn, can have a considerable impact on their relationships and learning dynamics. For that reason, it is the purpose of this article to present an analysis of interaction, cooperation, and learning relationships among several types of actors pertaining to an LPS in the farming equipment and machinery sector, bearing in mind the specificities of small enterprises. To this end, the fieldwork carried out in this study aimed at: (i) investigating external and internal knowledge sources conducive to learning and (ii) identifying and analyzing motivating and inhibiting factors related to specificities of small enterprises in order to bring the LPS members closer together and increase their cooperation and interaction. Empirical evidence shows that internal aspects of the enterprises, related to management and infrastructure, can have a strong bearing on their joint actions, interaction and learning processes.