1000 resultados para Mosca-dos-fungos
Resumo:
2016
Resumo:
One of the main objectives of applying edible coatings on fruits surface is to create a protective film to reduce weight loss due to evaporation and transpiration and also to decrease the risk of fruit rot caused by environmental contamination, in order to improve the visual aspect. Therefore, it is possible to increase shelf life, and decrease post harvest losses. Persimmon is a much appreciated fruit, with high potential for export, but sensitive to handling and storage. This study aimed to evaluate the effect of applying the edible coating Megh Wax ECF-124 (18% of active composts, consisting of emulsion of carnauba wax, anionic surfactant, preservative and water) produced by Megh Industry and Commerce Ltda in three different concentrations (25, 50 and 100%) on post harvest quality of 'Fuyu' persimmon stored for 14 days. The attributes evaluated for quality were: firmness, pH, acidity, soluble solids, weight loss and color. The results showed that application of carnauba wax in different concentrations was effective on decreasing weight loss of persimmon cv. Fuyu and maintenance of color aspects. Treatment at lower concentration, 25%, showed lower rate of discharge, but high concentrations showed lower values of mass loss. Carnauba wax application showed a high potential for use on postharvest conservation, and can be applied together with other technologies, helping to maintain quality for export.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
A case of brain abscess and meningitis due to pigmented fungi is reported. The patient was a 59-year-old white male, who had enjoyed excellent health until October 1977, when he developed headache, later accompanied by paresthesias and weakness in the left-sided extremities. These symptoms worsened progressively and in November of that year he had to quit his job. From February 1978 on he became inactive and anorexic. Intense continuous headache was associated with frequent episodes of vomiting. He gradually became tor-porous, and according to his relatives, suffered from visual and possibly auditory deficiency. On examination, he was malnourished and dehydrated, with decubitus ulcers. Temperature was 38,5°C. A left-sided spastic hemiplegia and prominent meningorradicular signs were noted. The CSF was examined six times between May 17th and June 1st and showed variable hypercytosis (143 to 4,437 leucocytes/ cu mm) with predominance of neutrophils (up tp 95%), low glucose and high protein concentrations. No microorganisms were identified. Electroencephalographic study disclosed a low background activity especially in left temporal areas. Despite supportive care and antibiotic therapy he lapsed into coma. Carotid angiography was normal on June 1st. He remained in deep coma until his death on June 6th, 1978. Necropsy was limited to the brain, which weighed 1,550 g after fixation and showed diffuse intense edema and hyperemia. On coronal sectioning an encapsulated abscess was found in the right basal ganglia, which also involved the internal capsule, and measured 1.5 cm in diameter. Microscopical examination disclosed large numbers of brownish fungi, appearing both as oval yeasts and as septate hyphae in the thick fibrous capsule and in the necrotic content of the abscess. The same organisms were demonstrated in moderate numbers in the leptomeninges of the medulla oblongata and , less frequently, of the hippo-campal region and cerebellum.
Resumo:
PURPOSE: The aim of this study was to assess the contamination status of endodontic absorbent paper points from sterilized or not sterilized commercial packs, as well as paper points exposed to the dental office environment. METHODS: Twenty absorbent paper points were evaluated for contamination status packed under different conditions: commercial/sterilized pack, commercial/non-sterilized pack, exposed to the clinical environment, and intentionally contaminated (positive control). Contamination was determined qualitatively and quantitatively by aerobiosis, capnophilic growth, and pour plate. The Petri dishes were analyzed with a colony counter, and the results were expressed as colony-forming units. The data were analyzed by Kruskal-Wallis test (α=0.05). RESULTS: No difference in colony-forming units was found among the groups of endodontic absorbent paper points. All groups were contaminated by fungi and bacteria. CONCLUSION: It can be concluded that the sterilization of absorbent endodontic paper points before clinical use should be recommended regardless of commercial presentation
Resumo:
In this work, different reactions in vitro between an environmental bacterial isolate and fungal species were related. The Gram-positive bacteria had terminal and subterminal endospores, presented metabolic characteristics of mesophilic and acidophilic growth, halotolerance, positive to nitrate reduction and enzyme production, as caseinase and catalase. The analysis of partial sequences containing 400 to 700 bases of the 16S ribosomal RNA gene showed identity with the genus Bacillus. However, its identity as B. subtilis was confirmed after analyses of the rpoB, gyrA, and 16S rRNA near-full-length sequences. Strong inhibitory activity of environmental microorganisms, such as Penicillium sp, Aspergillus flavus, A. niger, and phytopathogens, such as Colletotrichum sp, Alternaria alternata, Fusarium solani and F. oxysporum f.sp vasinfectum, was shown on co-cultures with B. subtilis strain, particularly on Sabouraud dextrose agar (SDA) and DNase media. Red and red-ochre color pigments, probably phaeomelanins, were secreted by A. alternata and A. niger respectively after seven days of co-culture.
Resumo:
The fungus-farming ant genus Mycetagroicus Brandão & Mayhé-Nunes was proposed based on three species from the Brazilian "Cerrado": M. cerradensis, M. triangularis and M. urbanus. Here we describe a new species of Attini ant of the genus Mycetagroicus, M. inflatus n. sp., based on two workers collected in eastern Pará State, Brazil. A new key for species identification, comments on differences among species and new geographical distribution data are furnished.
Resumo:
Um eqüino de nove anos de idade apresentou ausência de ar expirado e secreção serossanguinolenta na narina direita, associado a ruído respiratório. Os exames endoscópico e radiológico mostraram uma formação de aproximadamente seis centímetros de diâmetro recoberta por mucosa amarelada, que obstruía a cavidade nasal direita e insinuava-se para a cavidade nasal esquerda. Tal massa foi ressecada por meio de sinusotomia frontal direita. O exame histológico e a cultura revelaram lesão granulomatosa causada por fungos. O tratamento pós-operatório compreendeu associação de antibiótico e antiinflamatório, assim como de lavagens com água destilada e chá de camomila.
Resumo:
The aim of this study was to estimate the indoor and outdoor concentrations of fungal spores in the Metropolitan Area of Sao Paulo (MASP), collected at different sites in winter/spring and summer seasons. The techniques adopted included cultivation (samples collected with impactors) and microscopic enumeration (samples collected with impingers). The overall results showed total concentrations of fungal spores as high as 36,000 per cubic meter, with a large proportion of non culturable spores (around 91 per cent of the total). Penicillium sp. and Aspergillus sp. were the dominant species both indoors and outdoors, in all seasons tested, occurring in more than 30 per cent of homes at very high concentrations of culturable airborne fungi [colony forming units(CFU) m−3]. There was no significant difference between indoor and outdoor concentrations. The total fungal spore concentration found in winter was 19 per cent higher than that in summer. Heat and humidity were the main factors affecting fungal growth; however, a non-linear response to these factors was found. Thus, temperatures below 16°C and above 25°C caused a reduction in the concentration (CFU m−3) of airborne fungi, which fits with MASP climatalogy. The same pattern was observed for humidity, although not as clearly as with temperature given the usual high relative humidity (above 70 per cent) in the study area. These results are relevant for public health interventions that aim to reduce respiratory morbidity among susceptible populations
Resumo:
Intravenous challenge with Trypanosoma cruzi can be used to investigate the process and consequences of blood parasite clearance in experimental Chagas disease. One hour after intravenous challenge of chronically infected mice with 5610 6 trypomastigotes, the liver constituted a major site of parasite accumulation, as revealed by PCR. Intact parasites and/or parasite remnants were visualized at this time point scattered in the liver parenchyma. Moreover, at this time, many of liver-cleared parasites were viable, as estimated by the frequency of positive cultures, which considerably diminished after 48 h. Following clearance, the number of infiltrating cells in the hepatic tissue notably increased: initially (at 24 h) as diffuse infiltrates affecting the whole parenchyma, and at 48 h, in the form of large focal infiltrates in both the parenchyma and perivascular spaces. Phenotypic characterization of liver-infiltrating cells 24 h after challenge revealed an increase in Mac1(+), CD8(+) and CD4(+) cells, followed by natural killer (NK) cells. As evidence that liver-infiltrating CD4(+) and CD8(+) cells were activated, increased frequencies of CD69(+) CD8(+), CD69(+) CD4(+) and CD25(+) CD122(+) CD4(+) cells were observed at 24 and 48 h after challenge, and of CD25(-)CD122(+)CD4(+) cells at 48 h. The major role of CD4(+) cells in liver protection was suggested by data showing a very high frequency of interferon (IFN)-gamma-producing CD4(+) cells 24 h after challenge. In contrast, liver CD8(+) cells produced little IFN-gamma, even though they showed an enhanced potential for secreting this cytokine, as revealed by in vitro T cell receptor (TCR) stimulation. Confirming the effectiveness of the liver immune response in blood parasite control during the chronic phase of infection, no live parasites were detected in this organ 7 days after challenge.
Resumo:
Lymphangiomas are benign nonencapsulated lesions composed of sequestered noncommunicating lymphoid tissue lined by lymphatic endothelium and are thought to be caused by congenital obstruction of lymphatic drainage. They are subclassified by vessel size, such as the capillary, which is rare and located in subcutaneous tissue, cavernous (located about the mouth and tongue), and cystic (cystic hygromas). The cystic hygromas show a predilection for the neck (75%) and maxilla (20%), and the remaining 5% arise in rare locations such as the mediastinum, retroperitoneum, bone, kidney, colon, liver, spleen and scrotum. Only 3%-10% of neck lesions extend into the mediastinum. In this paper, we report a rare case of cystic hygroma with a huge dimension discussing the use of computed tomography scanning for diagnosis.
Resumo:
Este estudo teve como objetivo avaliar o potencial preservativo dos extrativos do cerne da madeira de teca (Tectona grandis) e a capacidade dos mesmos na mudança de coloração de madeiras claras. Para tanto, os resíduos gerados no processamento mecânico do cerne da madeira de teca com 20 anos de idade foram coletados e utilizados para realização de extrações. Para avaliar a influência dos extrativos de teca na cor e resistência natural da madeira foi utilizado o alburno da madeira de teca com 10 anos, além da madeira de Pinus sp., em função de ser uma madeira de coloração clara e baixa resistência natural. Foram realizadas extrações em água quente e etanol absoluto. Para determinação da concentração das soluções de tratamento foi realizado um ensaio de toxidez ao fungo Postia placenta. Após definida a concentração, as soluções extraídas foram preparadas para a impregnação. Além disto, foi utilizada uma terceira solução, composta pela combinação das soluções extraídas em água quente e etanol absoluto. Para cada solução testada foi realizado o tratamento pelo método de célula-cheia (Bethell). Para testar a eficiência das soluções preparadas com extrativos de teca, foram realizados leituras colorimétricas e ensaios biológicos com fungos e térmitas xilófagos. A combinação dos extrativos testados promoveu um escurecimento e reduziu a desuniformidade da cor, fazendo com que as madeiras tratadas se aproximassem mais da cor da madeira de cerne do que das amostras sem tratamento das respectivas espécies. A solução de extrativos obtida em etanol absoluto e a combinação dos extrativos obtidos em água quente e etanol absoluto promoveram os melhores resultados na resistência da madeira tratada contra fungos e térmitas xilófagos, alterando significativamente a classe de resistência das respectivas espécies tratadas.
Resumo:
Estudos da microbiologia da rinossinusite crônica mostram a presença de microorganismos aeróbicos, anaeróbicos, fungos e vírus e sua incidência varia de acordo com cada estudo. Estes estudos nos guiam para a escolha do antimicrobiano mais adequado para eliminar o processo infeccioso, ajudando a restaurar a mucosa nasossinusal. FORMA DE ESTUDO: Clínico prospectivo. OBJETIVO: O objetivo deste trabalho foi estudar a microbiologia dos seios maxilar e/ou etmoidal de pacientes com rinossinusite crônica e com indicação de cirurgia funcional endoscópica dos seios paranasais. MATERIAIS E MÉTODOS: Durante a cirurgia coletamos, em 41 pacientes, secreção e/ou fragmento de mucosa dos seios maxilar e/ou etmoidal para realização de bacterioscopia, pesquisa direta de fungos, cultura para microorganismos aeróbios, anaeróbios e fungos. RESULTADOS: Identificou-se a presença de microorganismos aeróbios em 21 pacientes (51,2%), anaeróbios em 16 (39%) e fungos em 1 (2,4%). Na população estudada, apenas em 12 (29,2%) o microorganismo isolado foi considerado patogênico quando analisado junto à contagem semiquantitativa de leucócitos. O Staphylococcus coagulase-negativo e o Staphylococcus aureus foram os microorganismos mais freqüentes, em 5 (12,1%) e em 4 pacientes (9,75%) respectivamente. CONCLUSÃO: Este estudo revela que o Staphylococcus coagulase-negative e o Staphylococcus aureus foram os microorganismos mais freqüentes isolados nos pacientes com rinossinusite crônica.
Resumo:
Este foi um estudo prospectivo que visou identificar a microbiologia do meato médio em pacientes com rinossinusite crônica (RSC) e compará-la com a de indivíduos sadios. MATERIAL E MÉTODOS: Foram incluídos 134 pacientes RSC e 50 voluntários sadios, que constituíram o grupo controle. As amostras foram coletadas endoscopicamente e submetidas a exames pelo método de Gram com contagem leucocitária e culturas para aeróbios, anaeróbios e fungos. RESULTADOS: Nos pacientes com RSC foram cultivados 220 microorganismos, dentre os quais os mais freqüentes foram o Staphylococcus aureus, presente em 31% das amostras, e o Staphylococcus coagulase-negativo (SCN) em 23%. Gram-negativos ou facultativos foram isolados em 37% das amostras, anaeróbios em 12%, e fungos em 14%. Ao exame bacterioscópico evidenciou-se alguns ou numerosos leucócitos em 74% das amostras com culturas positivas. Nos indivíduos sadios o SCN foi isolado em 40% das amostras e o Staphylococcus aureus em 18%. Em 12% dos indivíduos a cultura para fungos foi positiva, e o exame direto negativo. Todas as culturas anaeróbias foram estéreis. Quanto à contagem leucocitária todos apresentaram nenhum ou raros leucócitos. CONCLUSÃO: Os grupos apresentaram resultados semelhantes quanto à microbiologia, entretanto, diferiram em relação à contagem leucocitária, o que auxilia na diferenciação um microorganismo infectante de um colonizante.
Resumo:
Otite externa aguda é a infecção do conduto auditivo externo, geralmente causada por flora polimicrobiana. OBJETIVO: Isolar, identificar e determinar a susceptibilidade antimicrobiana dos organismos causadores da otite externa (OE). MÉTODO: 27 swabs foram obtidos de 27 orelhas de pacientes portadores de OE para cultura e 22 microrganismos foram isolados para avaliação de susceptibilidade. A susceptibilidade in vitro foi obtida através do método de ágar difusão em disco e os resultados, interpretados de acordo com critérios clínico-laboratoriais padrão. RESULTADOS: 10 culturas positivas para S. aureus, 8 culturas para P.aeruginosa, 5 para P.aeruginosa e S.aureus e 4 para fungos (Candida albicans e C. krusei). Gentamicina e as quinolonas foram ativas contra todas as cepas testadas, havendo resistência significativa contra amoxicilina/clavulanato. As espécies de Candida testadas foram sensíveis à Anfotericina B, nistatina, fluconazol e clotrimazol e resistentes à miconazol. CONCLUSÃO: A otite externa aguda é uma infecção polimicrobiana, e o conhecimento apropriado da etiologia e susceptibilidade dos microrganismos irá contribuir para o uso racional de antibióticos e o sucesso do tratamento.