977 resultados para Detection, Optimisation, Assessment, Highway
Resumo:
Attention deficit hyperactivity disorder (ADHD) is characterized by a persistent pattern of inattention and/or hyperactivity/impulsivity. The aim of this research was to contribute more precisely to the diagnosis of ADHD, to propose a battery of neuropsychological assessment and to analyze the contribution of each test. We studied 10 matched pairs of children with ADHD and normal controls (7 to 11 years). Inclusion criteria were: presence of ADHD typical behavior, positive diagnosis of ADHD based on DSM-IV, normal IQ, normal neurological examination and parental consent. We used extensive neuropsychological battery. The results showed differential sensitivity for detection of attentional problems in children with ADHD, although most tests did not reach statistical significance. The item, errors, of WCST revealed statistically significant difference between the two groups: ADHD performance was inferior to controls . In conclusion the neuropsychological assessment battery used in this research contributed to the diagnosis of ADHD.
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
OBJECTIVE: To characterize the behavior of premature newborns in the first year of chronological age. METHODS: This is a cross-sectional descriptive study, bound to a longitudinal study titled: Comparison of visual behavior on the first quarter of year of life of premature nursling born at two maternities of Recife/PE. The sample was composed by 52 premature newborns selected from June, 2007 to June, 2008 from the Maternity of the Federal University of Pernambuco (UFPE). Biological, socioeconomic and demographic data was collected through medical records and interviews with progeny. Newborns were evaluated by the Assessment Guide of Visual Ability in Infants. RESULTS: Most of the newborns were male at a gestational period between 33 weeks and 36 weeks and 6 days, showed a good visual behavior development for the age researched, and most of the families showed good socioeconomical and demographic profile. Besides, it was possible to detect ocular signs in 19% of sample, that were referred to an Ophthalmology Service. CONCLUSION: This study results point out the method like an important key in the early detection and visual screening for premature nursling since the first month of life and it led us to believe that clinical view for occupational therapy intervention must be focused not only on biological risks but also at the influence environment in newborn performance.
Resumo:
PURPOSE: To evaluate the ocular surface toxicity of two nitric oxide donors in ex vivo and in vivo animal models: S-nitrosoglutathione (GSNO) and S-nitroso-N-acetylcysteine (SNAC) in a hydroxypropyl methylcellulose (HPMC) matrix at final concentrations 1.0 and 10.0 mM. METHODS: Ex vivo GSNO and SNAC toxicities were clinically and histologically analyzed using freshly excised pig eyeballs. In vivo experiments were performed with 20 albino rabbits which were randomized into 4 groups (5 animals each): Groups 1 and 2 received instillations of 150 µL of aqueous HPMC solution containing GSNO 1.0 and 10.0 mM, respectively, in one of the eyes; Groups 3 and 4 received instillations of 150 µL of aqueous HPMC solution-containing SNAC 1.0 and 10.0 mM, respectively, in one of the eyes. The contralateral eyes in each group received aqueous HPMC as a control. All animals underwent clinical evaluation on a slit lamp and the eyes were scored according to a modified Draize eye test and were histologically analyzed. RESULTS: Pig eyeballs showed no signs of perforation, erosion, corneal opacity or other gross damage. These findings were confirmed by histological analysis. There was no difference between control and treated rabbit eyes according to the Draize eye test score in all groups (p>0.05). All formulations showed a mean score under 1 and were classified as non-irritating. There was no evidence of tissue toxicity in the histological analysis in all animals. CONCLUSION: Aqueous HPMC solutions containing GSNO and SNAC at concentrations up to 10.0 mM do not induce ocular irritation.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Noncarious cervical lesions (NCCLs) are considered to be of multifactorial origin, normally associated with inadequate brushing. This study assessed the influence in vitro of simulated brushing on NCCL formation. Fifteen human premolars were submitted to brushing in the cementoenamel junction region, using hard-, medium- and soft-bristled brushes associated with a toothpaste of medium abrasiveness under a 200 g load, at a speed of 356 rpm for 100 minutes. The surface topography of the region was analyzed before and after brushing, by means of a laser interferometer, using "cut-off" values of 0.25 and considering roughness values in mm. The initial roughness (mm) results for dentin (D / bristle consistency: 1 - soft, 2 - medium and 3 - hard) were as follows: (D1) 1.25 ± 0.45; (D2) 1.12 ± 0.44; (D3) 1.05 ± 0.41. For enamel (E / bristle consistency: 1 - soft, 2 - medium and 3 - hard), the initial results were: (E1) 1.18 ± 0.35; (E2) 1.32 ± 0.25; (E3) 1.50 ± 0.38. After brushing, the following were the values for dentin: (D1) 2.32 ± 1.99; (D2) 3.30 ± 0.96; (D3) Over 500. For enamel, the values after brushing were: (E1) 1.37 ± 0.31; (E2) 2.15 ± 0.90; (E3) 1.22 ± 0.47. Based on the results of the ANOVA and Tukey statistical analyses (a = .05) it was concluded that soft, medium and hard brushes are not capable of abrading enamel, whereas dentin showed changes in surface roughness by the action of medium- and hard-bristled brushes.
Resumo:
Owing to improvements in its mechanical properties and to the availability of shade and translucence resources, resin composite has become one of the most widely used restorative materials in present day Dentistry. The aim of this study was to assess the relation between the surface hardness of seven different commercial brands of resin composites (Charisma, Fill Magic, Master Fill, Natural Look, Opallis, Tetric Ceram, and Z250) and the different degrees of translucence (translucid, enamel and dentin). Vickers microhardness testing revealed significant differences among the groups. Z250 was the commercial brand that showed the best performance in the hardness test. When comparing the three groups assessed within the same brand, only Master Fill and Fill Magic presented statistically significant differences among all of the different translucencies. Natural Look was the only one that showed no significant difference among any of the three groups. Charisma, Opallis, Tetric Ceram and Z250 showed significant differences among some of the tested groups. Based on the results found in this study, it was not possible to establish a relation between translucence and the microhardness of the resin composites assessed. Depending on the material assessed, however, translucence variation did affect the microhardness values of the resin composites.
Resumo:
Tooth shade results from the interaction between enamel color, enamel translucency and dentine color. A change in any of these parameters will change a tooth’s color. The objective of this study was to evaluate the changes occurring in enamel translucency during a tooth whitening process. Fourteen human tooth enamel fragments, with a mean thickness of 0.96 mm (± 0.3 mm), were subjected to a bleaching agent (10% carbamide peroxide) 8 hours per day for 28 days. The enamel fragment translucency was measured by a computer controlled spectrophotometer before and after the bleaching agent applications in accordance with ANSI Z80.3-1986 - American National Standard for Ophthalmics - nonprescription sunglasses and fashion eyewear-requirements. The measurements were statistically compared by the Mann-Whitney non-parametric test. A decrease was observed in the translucency of all specimens and, consequently, there was a decrease in transmittance values for all samples. It was observed that the bleaching procedure significantly changes the enamel translucency, making it more opaque.
Resumo:
Conventional radiography has shown limitation in acquiring image of the ATM region, thus, computed tomography (CT) scanning has been the best option to the present date for diagnosis, surgical planning and treatment of bone lesions, owing to its specific properties. OBJECTIVE: The aim of the study was to evaluate images of simulated bone lesions at the head of the mandible by multislice CT. MATERIAL AND METHODS: Spherical lesions were made with dental spherical drills (sizes 1, 3, and 6) and were evaluated by using multislice CT (64 rows), by two observers in two different occasions, deploying two protocols: axial, coronal, and sagittal images, and parasagittal images for pole visualization (anterior, lateral, posterior, medial and superior). Acquired images were then compared with those lesions in the dry mandible (gold standard) to evaluate the specificity and sensibility of both protocols. Statistical methods included: Kappa statistics, validity test and chi-square test. Results demonstrated the advantage of associating axial, coronal, and sagittal slices with parasagittal slices for lesion detection at the head of the mandible. RESULTS: There was no statistically significant difference between the types of protocols regarding a particular localization of lesions at the poles. CONCLUSIONS: Protocols for the assessment of the head of the mandible were established to improve the visualization of alterations of each of the poles of the mandible's head. The anterior and posterior poles were better visualized in lateral-medial planes while lateral, medial and superior poles were better visualized in the anterior-posterior plane.
Resumo:
There are many limitations to image acquisition, using conventional radiography, of the temporomandibular joint (TMJ) region. The Computed Tomography (CT) scan is a better option, due to its higher accuracy, for purposes of diagnosis, surgical planning and treatment of bone injuries. The aim of the present study was to analyze two protocols of cone beam computed tomography for the evaluation of simulated mandibular condyle bone lesions. Spherical lesions were simulated in 30 dry mandibular condyles, using dentist drills and drill bits sizes 1, 3 and 6. Each of the mandibular condyles was submitted to cone beam computed tomography (CBCT) using two protocols: 1) axial, coronal and sagittal multiplanar reconstruction (MPR); and 2) sagittal plus coronal slices throughout the longitudinal axis of the mandibular condyles. For these protocols, 2 observers analyzed the CBCT images independently, regarding the presence or not of injuries. Only one of the observers, however, performed on 2 different occasions. The results were compared to the gold standard, evaluating the percentage of agreement, degree of accuracy of CBCT protocols and observers' examination. The z test was used for the statistical analysis. The results showed there were no statistically significant differences between the 2 protocols. There was greater difficulty in the assessment of small-size simulated lesions (drill # 1). From the results of this study, it can be concluded that CBCT is an accurate tool for analyzing mandibular condyle bone lesions, with the MPR protocol showing slightly better results than the sagittal plus coronal slices throughout the longitudinal axis.
Resumo:
Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.
Resumo:
Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.