945 resultados para All-cause
Resumo:
To describe maternal and neonatal outcomes in pregnant women undergoing hemodialysis in a referral center in Brazilian Southeast side. Retrospective and descriptive study, with chart review of all pregnancies undergoing hemodialysis that were followed-up at an outpatient clinic of high- risk prenatal care in Southeast Brazil. Among the 16 women identified, 2 were excluded due to follow-up loss. In 14 women described, hypertension was the most frequent cause of chronic renal failure (half of cases). The majority (71.4%) had performed hemodialysis treatment for more than one year and all of them underwent 5 to 6 hemodialysis sessions per week. Eleven participants had chronic hypertension, 1 of which was also diabetic, and 6 of them were smokers. Regarding pregnancy complications, 1 of the hypertensive women developed malignant hypertension (with fetal growth restriction and preterm delivery at 29 weeks), 2 had acute pulmonary edema and 2 had abruption placenta. The mode of delivery was cesarean section in 9 women (64.3%). All neonates had Apgar score at five minutes above 7. To improve perinatal and maternal outcomes of women undergoing hemodialysis, it is important to ensure multidisciplinary approach in referral center, strict control of serum urea, hemoglobin and maternal blood pressure, as well as close monitoring of fetal well-being and maternal morbidities. Another important strategy is suitable guidance for contraception in these women.
Resumo:
Yeast flocculation (Saccharomyces cerevisiae) is one of the most important problems in fuel ethanol production. Yeast flocculation causes operational difficulties and increase in the ethanol cost. Proteolytic enzymes can solve this problem since it does not depend on these changes. The recycling of soluble papain and the immobilization of this enzyme on chitin or chitosan were studied. Some cross-linking agents were evaluated in the action of proteolytic activity of papain. The glutaraldehyde (0.1-10% w·v(-1)), polyethyleneimine (0.5% v·v(-1)), and tripolyphosphate (1-10% w·v(-1)) inactivated the enzyme in this range, respectively. Glutaraldehyde inhibited all treatments of papain immobilization. The chitosan cross-linked with TPP in 5 h of reaction showed the yield of active immobilized enzyme of 15.7% and 6.07% in chitosan treated with 0.1% PEI. Although these immobilizations have been possible, these levels have not been enough to cause deflocculation of yeast cells. Free enzyme was efficient for yeast deflocculation in dosages of 3 to 4 g·L(-1). Recycling of soluble papain by centrifugation was effective for 14 cycles with yeast suspension in time perfectly compatible to industrial conditions. The reuse of proteases applied after yeast suspension by additional yeast centrifugation could be an alternative to cost reduction of these enzymes.
Resumo:
To report on the use of chronic myeloid leukemia as a theme of basic clinical integration for first year medical students to motivate and enable in-depth understanding of the basic sciences of the future physician. During the past thirteen years we have reviewed and updated the curriculum of the medical school of the Universidade Estadual de Campinas. The main objective of the new curriculum is to teach the students how to learn to learn. Since then, a case of chronic myeloid leukemia has been introduced to first year medical students and discussed in horizontal integration with all themes taught during a molecular and cell biology course. Cell structure and components, protein, chromosomes, gene organization, proliferation, cell cycle, apoptosis, signaling and so on are all themes approached during this course. At the end of every topic approached, the students prepare in advance the corresponding topic of clinical cases chosen randomly during the class, which are then presented by them. During the final class, a paper regarding mutations in the abl gene that cause resistance to tyrosine kinase inhibitors is discussed. After each class, three tests are solved in an interactive evaluation. The course has been successful since its beginning, 13 years ago. Great motivation of those who participated in the course was observed. There were less than 20% absences in the classes. At least three (and as many as nine) students every year were interested in starting research training in the field of hematology. At the end of each class, an interactive evaluation was performed and more than 70% of the answers were correct in each evaluation. Moreover, for the final evaluation, the students summarized, in a written report, the molecular and therapeutic basis of chronic myeloid leukemia, with scores ranging from 0 to 10. Considering all 13 years, a median of 78% of the class scored above 5 (min 74%-max 85%), and a median of 67% scored above 7. Chronic myeloid leukemia is an excellent example of a disease that can be used for clinical basic integration as this disorder involves well known protein, cytogenetic and cell function abnormalities, has well-defined diagnostic strategies and a target oriented therapy.
Resumo:
Introduction. Noise is a major cause of health disorders in workers and has unique importance in the auditory analysis of people exposed to it. The purpose of this study is to evaluate the arithmetic mean of the auditory thresholds at frequencies of 3, 4, and 6 kHz of workers from five professional categories exposed to occupational noise. Methods. We propose a retrospective cross-sectional cohort study to analyze 2.140 audiograms from seven companies having five sectors of activity: one footwear company, one beverage company, two ceramics companies, two metallurgical companies, and two transport companies. Results. When we compared two categories, we noticed a significant difference only for cargo carriers in comparison to the remaining categories. In all activity sectors, the left ear presented the worst values, except for the footwear professionals (P > 0.05). We observed an association between the noise exposure time and the reduction of audiometric values for both ears. Significant differences existed for cargo carriers in relation to other groups. This evidence may be attributed to different forms of exposure. A slow and progressive deterioration appeared as the exposure time increased.
Resumo:
Oropouche virus (OROV) is a member of the Orthobunyavirus genus in the Bunyaviridae family and a prominent cause of insect-transmitted viral disease in Central and South America. Despite its clinical relevance, little is known about OROV pathogenesis. To define the host defense pathways that control OROV infection and disease, we evaluated OROV pathogenesis and immune responses in primary cells and mice that were deficient in the RIG-I-like receptor signaling pathway (MDA5, RIG-I, or MAVS), downstream regulatory transcription factors (IRF-3 or IRF-7), IFN-β, or the receptor for type I IFN signaling (IFNAR). OROV replicated to higher levels in primary fibroblasts and dendritic cells lacking MAVS signaling, the transcription factors IRF-3 and IRF-7, or IFNAR. In mice, deletion of IFNAR, MAVS, or IRF-3 and IRF-7 resulted in uncontrolled OROV replication, hypercytokinemia, extensive liver damage, and death whereas wild-type (WT) congenic animals failed to develop disease. Unexpectedly, mice with a selective deletion of IFNAR on myeloid cells (CD11c Cre(+) Ifnar(f/f) or LysM Cre(+) Ifnar(f/f)) did not sustain enhanced disease with OROV or La Crosse virus, a closely related encephalitic orthobunyavirus. In bone marrow chimera studies, recipient irradiated Ifnar(-/-) mice reconstituted with WT hematopoietic cells sustained high levels of OROV replication and liver damage, whereas WT mice reconstituted with Ifnar(-/-) bone marrow were resistant to disease. Collectively, these results establish a dominant protective role for MAVS, IRF-3 and IRF-7, and IFNAR in restricting OROV virus infection and tissue injury, and suggest that IFN signaling in non-myeloid cells contributes to the host defense against orthobunyaviruses. Oropouche virus (OROV) is an emerging arthropod-transmitted orthobunyavirus that causes episodic outbreaks of a debilitating febrile illness in humans in countries of South and Central America. The continued expansion of the range and number of its arthropod vectors increases the likelihood that OROV will spread into new regions. At present, the pathogenesis of OROV in humans or other vertebrate animals remains poorly understood. To define cellular mechanisms of control of OROV infection, we performed infection studies in a series of primary cells and mice that were deficient in key innate immune genes involved in pathogen recognition and control. Our results establish that a MAVS-dependent type I IFN signaling pathway has a dominant role in restricting OROV infection and pathogenesis in vivo.
Resumo:
Multidrug-resistant microbial infections represent an exponentially growing problem affecting communities worldwide. Photodynamic therapy is a promising treatment based on the combination of light, oxygen, and a photosensitizer that leads to reactive oxygen species production, such as superoxide (type I mechanism) and singlet oxygen (type II mechanism) that cause massive oxidative damage and consequently the host cell death. Indigofera genus has gained considerable interest due its mutagenic, cytotoxic, and genotoxic activity. Therefore, this study was undertaken to investigate the effect of crude extracts, alkaloidal fraction, and isolated substance derived from Indigofera truxillensis in photodynamic antimicrobial chemotherapy on the viability of bacteria and yeast and evaluation of mechanisms involved. Our results showed that all samples resulted in microbial photoactivation in subinhibitory concentration, with indigo alkaloid presenting a predominant photodynamic action through type I mechanism. The use of CaCl2 and MgCl2 as cell permeabilizing additives also increased gram-negative bacteria susceptibility to indigo.
Resumo:
Crohn´s disease (CD) is a chronic transmural inflammation of the gastrointestinal tract of unknown cause. Malnutrition associated with active CD has been reduced although obesity has increased. Dietary strategies such as those with high-protein have been proposed to reduce body fat. This study compares the effects of two supplements on the nutritional status of CD patients. 68 CD patients were randomized in two groups: whey protein group (WP) and soy protein group (SP). Using bioimpedance analysis, anthropometry and albumin and pre-albumin dosages the nutritional status was measured before starting the intervention and after 8 and 16 weeks. The disease activity was determined by Crohn's Disease Activity Index and serum C-reactive protein dosage and dietary intake by 24h dietary recalls. Forty-one patients concluded the study and both supplements changed body composition similarly. Triceps skin fold thickness (p< 0.001) and body fat percentage (p=0.001) decreased, whereas mid-arm muscle circumference (p=0.004), corrected arm muscle area (p=0.005) and body lean percentage (p=0.001) increased. For Crohn's disease patients undergoing anti TNF-alpha and azatioprine therapies, supplementation with whey and soy proteins changes body composition through reduction of body fat and thus contributes to control inflammation.
Resumo:
In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.
Resumo:
Avian Pathogenic Escherichia coli (APEC) strains are extra-intestinal E. coli that infect poultry and cause diseases. Nitrite is a central branch-point in bacterial nitrogen metabolism and is used as a cytotoxin by macrophages. Unlike nitric oxide (NO), nitrite cannot diffuse across bacterial membrane cells. The NirC protein acts as a specific channel to facilitate the transport of nitrite into Salmonella and E. coli cells for nitrogen metabolism and cytoplasmic detoxification. NirC is also required for the pathogenicity of Salmonella by downregulating the production of NO by the host macrophages. Based on an in vitro microarray that revealed the overexpression of the nirC gene in APEC strain SCI-07, we constructed a nirC-deficient SCI-07 strain (ΔnirC) and evaluated its virulence potential using in vivo and in vitro assays. The final cumulative mortalities caused by mutant and wild-type (WT) were similar; while the ΔnirC caused a gradual increase in the mortality rate during the seven days recorded, the WT caused mortality up to 24h post-infection (hpi). Counts of the ΔnirC cells in the spleen, lung and liver were higher than those of the WT after 48 hpi but similar at 24 hpi. Although similar number of ΔnirC and WT cells was observed in macrophages at 3 hpi, there was higher number of ΔnirC cells at 16 hpi. The cell adhesion ability of the ΔnirC strain was about half the WT level in the presence and absence of alpha-D-mannopyranoside. These results indicate that the nirC gene influences the pathogenicity of SCI-07 strain.
Resumo:
Lymphoma is the most common head and neck malignancy in children, and palatine tonsils asymmetry is the most frequent clinical manifestation of tonsillar lymphoma. However, several studies with children with tonsillar asymmetry found no case of lymphoma, showing that the relationship of tonsillar asymmetry with lymphoma is unclear. In this review, we aimed to identify the association between tonsillar asymmetry and tonsillar lymphoma in children by conducting systematic reviews of the literature on children with palatine tonsil lymphoma and tonsillar asymmetry. Articles comprising the paediatric age group (up to 18 years) with information concerning clinical manifestations of tonsillar lymphoma or the diagnosis of the tonsillar asymmetry were included. The main cause of asymmetry of palatine tonsils was lymphoid hyperplasia, followed by lymphoma and nonspecific benign changes. The asymmetry of tonsils was present in 73.2% of cases of lymphoma. There was an association between asymmetric palatine tonsils and lymphoma, with a likelihood ratio of 43.5 for children with asymmetry of palatine tonsils and 8938.4 for children with asymmetry of tonsils and other signs of suspicion for malignancy. We also provide recommendations on the management of suspicious cases of palatine tonsil lymphoma.
Resumo:
Spinocerebellar ataxia type 1 (SCA1), spinocerebellar ataxia type 2 (SCA2) and Machado-Joseph disease or spinocerebellar ataxia type 3 (MJD/SCA3) are three distinctive forms of autosomal dominant spinocerebellar ataxia (SCA) caused by expansions of an unstable CAG repeat localized in the coding region of the causative genes. Another related disease, dentatorubropallidoluysian atrophy (DRPLA) is also caused by an unstable triplet repeat and can present as SCA in late onset patients. We investigated the frequency of the SCA1, SCA2, MJD/SCA3 and DRPLA mutations in 328 Brazilian patients with SCA, belonging to 90 unrelated families with various patterns of inheritance and originating in different geographic regions of Brazil. We found mutations in 35 families (39%), 32 of them with a clear autosomal dominant inheritance. The frequency of the SCA1 mutation was 3% of all patients; and 6 % in the dominantly inherited SCAs. We identified the SCA2 mutation in 6% of all families and in 9% of the families with autosomal dominant inheritance. The MJD/SCA3 mutation was detected in 30 % of all patients; and in the 44% of the dominantly inherited cases. We found no DRPLA mutation. In addition, we observed variability in the frequency of the different mutations according to geographic origin of the patients, which is probably related to the distinct colonization of different parts of Brazil. These results suggest that SCA may be occasionally caused by the SCA1 and SCA2 mutations in the Brazilian population, and that the MJD/SCA3 mutation is the most common cause of dominantly inherited SCA in Brazil.
Resumo:
This paper aims to identify and analyze the reasons pointed by mothers to prolong breastfeeding beyond the first year of the child s life. The study involved 40 mothers whose children were treated in the Preventive Program of Research and Dental Treatment Center for Special Patients - Dental School of Piracicaba - UNICAMP. The group consisted of mothers who prolonged the breastfeeding beyond the baby s first year of life. All mothers were surveyed by a researcher using a specific questionnaire. In order to avoid information loss, the interviews were taped, then transcripted. Results showed that the main cause of the extended breastfeeding was maternal pleasure. It was also observed that the mother and infant attachment favors prolonged breastfeeding occurrence. Further studies should be carried out for more accurate functional analyses of variable that lead to extend breastfeeding or to wean.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Type II 3β-hydroxysteroid dehydrogenase/Δ5-Δ4-isomerase (3β-HSD2), encoded by the HSD3B2 gene, is a key enzyme involved in the biosynthesis of all the classes of steroid hormones. Deleterious mutations in the HSD3B2 gene cause the classical deficiency of 3β-HSD2, which is a rare autosomal recessive disease that leads to congenital adrenal hyperplasia (CAH). CAH is the most frequent cause of ambiguous genitalia and adrenal insufficiency in newborn infants with variable degrees of salt losing. Here we report the molecular and structural analysis of the HSD3B2 gene in a 46,XY child, who was born from consanguineous parents, and presented with ambiguous genitalia and salt losing. The patient carries a homozygous nucleotide c.665C>A change in exon 4 that putatively substitutes the proline at codon 222 for glutamine. Molecular homology modeling of normal and mutant 3β-HSD2 enzymes emphasizes codon 222 as an important residue for the folding pattern of the enzyme and validates a suitable model for analysis of new mutations.
Resumo:
Purpose: To identify improvement in visual performance of low vision students after assessment and management conducted at the Low Vision Service of State University of Campinas (UNICAMP). Method: Fourteen low vision students aged six to 30 years, attended in a room with resources for visual deficiency in Americana and Santa Bárbara d'Oeste -- SP during 1998 received complete ophthalmologic examination, specialized low vision assessment and educational intervention. Results: The most prevalent cause of vision loss was operated congenital cataract with four cases (28.6%), followed by congenital bilateral toxoplasmic macular scars and eye malformation, both with two cases (14.3%) cases each. Eight students (57.2%) had acuity classified as severe vision loss, four (28.6%) profound, one (7.1%) moderate and one (7.1%) nearly normal vision. Twelve (85.7%) were behind expected school grade. Optical aids were prescribed for 12 (85.8%) students but only 7 (58.3%) acquired the aids thus improving significantly their school performance. Conclusion: All students improved school performance even considering that 12 (85.7%) had severe to profound vision loss. As a group their performance could even be better if the optical aid prescriptions were acquired by all. This indicates the need of a social work to support such needs. For good results at school and effective student inclusion a partnership between school, family and specialized education is necessary. We recommend to promote the benefits of the resource room.