998 resultados para sulco simples
Resumo:
The aim of this research was to study the effect of chemical additives (lime and Portland cement) associated with sodium silicate on soil in order to obtain compressed soil bricks. Mini panels were constructed with such bricks being their physical and mechanical characteristics determined in laboratory conditions and their behavior evaluated through the association of destructive and non-destructive methods. For this purpose a sandy soil and a finely divided one were added to Portland cement and lime in the dosage of 6% and 10% taken in dry weight basis in relation to the dry soil. The sodium silicate dosage of 4% was also taken in dry weight basis in relation to the dry soil-cement or to the dry soil-lime. The compressed soil bricks were cured in a humidity chamber for 7; 28; 56 and 91 days. The bricks were laid on the fourteenth day to form prismatic mini panels each one with four layers of bricks. After 28; 56 and 91 days the mini panels were submitted to both; ultrasonic and compressive tests to determine its elastic properties (dynamic modulus) and the compressive resistance. The best results in terms of compressive strength, water absorption capacity or dynamic elastic modulus, were reached by the sandy soil added to 10% of Portland cement or lime associated with sodium silicate.
Resumo:
The main objective of this work is the study of the effect of rice husk addition on the physical and mechanical properties of soil-cement, in order to obtain an alternative construction material. The rice husk preparation consisted of grinding, sieving, and the pre-treatment with lime solution. The physical characteristics of the soil and of the rice husk were determined. Different amounts of soil, cement and rice husk were tested by compaction and unconfined compression. The specimens molded according to the treatments applied to the mixtures were subsequently submitted to compression testing and to tensile splitting cylinder testing at 7 and 28 days of age and to water absorption testing. After determining its physical and mechanical characteristics, the best results were obtained for the soil + 12% (cement + rice husk) mixture. The results showed a promising use as an alternative construction material.
Resumo:
The durability of the cellulose-cement composites is a decisive factor to introduce such material in the market. Polymers have been used in concrete and mortar production to increase its durability. The goal of this work was the physical and mechanical characterization of cellulose-cement composites modified by a polymer and the subsequent durability evaluation. The work also evaluated the dispersion of acrylic polymer in composites made of Pinus caribaea residues. The physical properties observed were water absorption by immersion and bulk density. Rupture modulus and toughness were determined by flexural test. The specimens were obtained from pads, produced by pressing and wet curing. Samples were subjected to accelerated aging tests by repeated wetting and drying cycles and hot-water bath and natural aging. The scanning electron microscopy (SEM) allowed verifying the fiber and composite characteristics along the time. For the composite range analyzed, it was observed the polymer improved the mechanical properties of composites besides a significant decreasing in water absorption. The use of polymer improved the performance of vegetable fiber-cement composites when compared to the conventional mortar, due to water absorption decreasing.
Resumo:
The rice husk and its ash are abundant and renewable and can be used to obtain alternative building materials. An increase in the consumption of such waste could help minimize the environmental problems from their improper disposal. This study aimed to evaluate the use of ashes as a cargo mineral (filler). However, the rice husk chemically interferes in the conduct of the based cement mixtures. Thus, different mixes cement-rice husk with and without the addition of ash were evaluated in order to highlight the influence of its components (husk; ash), which could otherwise be excluded or be underestimated. Cylindrical samples (test of simple compression and traction by diametrical compression) and samples extracted from manufactured pressed board (test of bending and parallel compression to the surface), were used to evaluate the behavior of different mixtures of components (rice hush; RHA - rice husk ahs). The results of the mechanical tests showed, in general, there is not a statistical difference between the mixtures, which are associated with the chemical suppressive effect of the rice husk ash. The mixture of rice husk of 10 mm, with an addition of 35% of the rice husk ash, is notable for allowing the highest consumption of rice husk and rice husk ash, to reduce 25% the consumption of cement and to allow the storage (without emissions to the atmosphere), around 1.9 ton of CO2 per ton of cement consumed, thus contributing to the reduction of CO2 emissions, which can stimulate rural constructions under an ecological point of view.
Resumo:
Rice husk, employed as an energy source at milling industries in Brazil generates, after burning, a dark ash. This residue is not yet conveniently disposed, being currently dumped on large areas, causing environmental problems. This research intended to evaluate the applications of residual rice husk ashes (RHA) as a partial replacement of cement for mortar production. Rice husk ash was chemically characterized through X-ray fluorescence, determination of carbon content, X-ray diffraction, and laser granulometric analysis. Mortar specimens were submitted to two different exposure conditions: internal and external environments at a maximum period of five months. Physical-mechanical testing were compressive strength and ultrasonic pulse velocity (UPV). Although presenting good mechanical performance, the mortar based on ash (RHA) did not present pozolanicity but it can be employed in cement matrices as inert material (filler).
Resumo:
The main objective of this work was to evaluate the linear regression between spectral response and soybean yield in regional scale. In this study were monitored 36 municipalities from the west region of the states of Parana using five images of Landsat 5/TM during 2004/05 season. The spectral response was converted in physical values, apparent and surface reflectances, by radiometric transformation and atmospheric corrections and both used to calculate NDVI and GVI vegetation indices. Those ones were compared by multiple and simple regression with government official yield values (IBGE). Diagnostic processing method to identify influents values or collinearity was applied to the data too. The results showed that the mean surface reflectance value from all images was more correlated with yield than individual dates. Further, the multiple regressions using all dates and both vegetation indices gave better results than simple regression.
Resumo:
The main purpose of this paper is to question the relationship between theory and practice or basic and applied research in the domain of Applied Linguistics and classroom discourse. In order to achieve our aim, some theoretical texts, some recorded and transcribed classes as well as some teachers and students opinions about reading and writing were analysed. Results have shown that 1) practice is not the direct application of theoretical data: the relationship between them is not as simple as some applied linguists seem to believe because of the action of the unconscious in the constitution of subjectivity; 2) the conceptualization of the theoretical issues takes place in a confused and disorderly manner mixed up with personal experiences and previous knowledge (practice). We intend to question the fact that practice comes as secondary to theory.
Resumo:
In this paper, I argue against the contemporary tendency to confine ideology to the sphere of subjectivity and point of view, as defended by Paul Simpson (1993) in his book Language, Ideology, and Point of View. My principal criticism against the view is that it simply amounts to a re-affirmation of certain of the conceptual categories with which we have for long been accustomed to think. Rather, I contend, we ought to try to interrogate those very categories with a view to teasing out the instabilities that characterise them. I argue that there is an urgent need to deconstruct the very opposition between ideology, point of view etc. on the one hand, and science, theory, or whatever that one might wish to posit on the other.
Resumo:
BACKGROUND: Changes in heart rate during rest-exercise transition can be characterized by the application of mathematical calculations, such as deltas 0-10 and 0-30 seconds to infer on the parasympathetic nervous system and linear regression and delta applied to data range from 60 to 240 seconds to infer on the sympathetic nervous system. The objective of this study was to test the hypothesis that young and middle-aged subjects have different heart rate responses in exercise of moderate and intense intensity, with different mathematical calculations. METHODS: Seven middle-aged men and ten young men apparently healthy were subject to constant load tests (intense and moderate) in cycle ergometer. The heart rate data were submitted to analysis of deltas (0-10, 0-30 and 60-240 seconds) and simple linear regression (60-240 seconds). The parameters obtained from simple linear regression analysis were: intercept and slope angle. We used the Shapiro-Wilk test to check the distribution of data and the t test for unpaired comparisons between groups. The level of statistical significance was 5%. RESULTS: The value of the intercept and delta 0-10 seconds was lower in middle age in two loads tested and the inclination angle was lower in moderate exercise in middle age. CONCLUSION: The young subjects present greater magnitude of vagal withdrawal in the initial stage of the HR response during constant load exercise and higher speed of adjustment of sympathetic response in moderate exercise.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The cerebral cysticercosis can produce intracranial hypertension by inflammatory obstruction of the basal cysterns or by expansive lesion in the cerebral parenchima or ventricular cavities. In the latter and in tumor cases the clinical picture is very similar and only after surgery can the etiology be determined. We present 11 operated cases of intracranial cysticercosis which presented the clinical picture of an expansive lesion. There were 7 females and 4 males with ages between 4 and 65 years. Nine patients were admitted because of headache, vomiting and visual disturbances suggestive of intracranial hypertension. One patient was admited with lymphocytic meningitis and another with focal seizures following hemiparesis. Five patients presented focal signs and six edema of the papilla. Epileptic manifestations were present in 45.5% of the cases. A plain X-ray films of the skull failed to reveal calcificatons, however signs of chronic hypertension were present in three cases. The electroencephalogram showed slow focal waves in 8 patients The spinal fluid examination revealed lymphocytosis in 4 cases, increased protein content in another 4 and complement fixation for cysticercosis was positive in 2 cases. The expansive lesions were localized by angiograph and ventriculography. In these the location was temporal in 4, frontal in 3, parietal in 2, in the third ventricle in one and in the fourth ventricle in another. At surgery we removed a large cyst from the cerebral parenchyma in six cases. Around the cyst a thick glial reaction was present. In the other cases the cyst was small but fixed to the ventricular trigone and produced dilatation of the inferior horn of the lateral ventricle. In two cases we removed a solitary intraventricular cyst from the third and fourth ventricles. In the two children operated upon there were several small hard cysts involving the cerebral parenchyma which displayed intense gliosis. There were no postoperative complications.
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física