935 resultados para reverse transcribed


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Size distributions in woody plant populations have been used to assess their regeneration status, assuming that size structures with reverse-J shapes represent stable populations. We present an empirical approach of this issue using five woody species from the Cerrado. Considering count data for all plants of these five species over a 12-year period, we analyzed size distribution by: a) plotting frequency distributions and their adjustment to the negative exponential curve and b) calculating the Gini coefficient. To look for a relationship between size structure and future trends, we considered the size structures from the first census year. We analyzed changes in number over time and performed a simple population viability analysis, which gives the mean population growth rate, its variance and the probability of extinction in a given time period. Frequency distributions and the Gini coefficient were not able to predict future trends in population numbers. We recommend that managers should not use measures of size structure as a basis for management decisions without applying more appropriate demographic studies.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study investigated the intrinsic and extrinsic motivacional orientations of students in the context of the educational continuous progression. The sample was composed of 160 subjects of second, fourth, sixth and eighth grades of the elementary school. Data was collected by means of the presentation of histories involving the intrinsic, extrinsic motivation and the educational continuous progression system. Subjects were interviewed individually. Their answers were transcribed verbatim and submitted to content analysis. Results indicated that a expressive percentage of students did not know the educational system of continuous progression. Students revealed a predominantly intrinsic motivation orientation with advances in age and in school grade level, even though knowing that they will not repeat any school grade. This study pointed out the importance of deepening our knowledge concerning the impact of the educational continuous progression in students' motivation to learn.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The main purpose of this paper is to question the relationship between theory and practice or basic and applied research in the domain of Applied Linguistics and classroom discourse. In order to achieve our aim, some theoretical texts, some recorded and transcribed classes as well as some teachers and students opinions about reading and writing were analysed. Results have shown that 1) practice is not the direct application of theoretical data: the relationship between them is not as simple as some applied linguists seem to believe because of the action of the unconscious in the constitution of subjectivity; 2) the conceptualization of the theoretical issues takes place in a confused and disorderly manner mixed up with personal experiences and previous knowledge (practice). We intend to question the fact that practice comes as secondary to theory.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of the present study was to determine whether lesion of the subthalamic nucleus (STN) promoted by N-methyl-D-aspartate (NMDA) would rescue nigrostriatal dopaminergic neurons after unilateral 6-hydroxydopamine (6-OHDA) injection into the medial forebrain bundle (MFB). Initially, 16 mg 6-OHDA (6-OHDA group) or vehicle (artificial cerebrospinal fluid - aCSF; Sham group) was infused into the right MFB of adult male Wistar rats. Fifteen days after surgery, the 6-OHDA and SHAM groups were randomly subdivided and received ipsilateral injection of either 60 mM NMDA or aCSF in the right STN. Additionally, a control group was not submitted to stereotaxic surgery. Five groups of rats were studied: 6-OHDA/NMDA, 6-OHDA/Sham, Sham/NMDA, Sham/Sham, and Control. Fourteen days after injection of 6-OHDA, rats were submitted to the rotational test induced by apomorphine (0.1 mg/kg, ip) and to the open-field test. The same tests were performed again 14 days after NMDA-induced lesion of the STN. The STN lesion reduced the contralateral turns induced by apomorphine and blocked the progression of motor impairment in the open-field test in 6-OHDA-treated rats. However, lesion of the STN did not prevent the reduction of striatal concentrations of dopamine and metabolites or the number of nigrostriatal dopaminergic neurons after 6-OHDA lesion. Therefore, STN lesion is able to reverse motor deficits after severe 6-OHDA-induced lesion of the nigrostriatal pathway, but does not protect or rescue dopaminergic neurons in the substantia nigra pars compacta.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study ascertained whether under dental erosion models that closely mimics the real-life situation enamel and root dentin from bovine origin would be reliable substitutes for human counterparts. Through a 2x2 crossover design, in a first trial, 14 volunteers wore a palatal device containing slabs of bovine and human enamel. Half of the participants ingested (4x daily, for 10 days) orange juice first, crossing over to mineral water, while the remainder received the reverse sequence. In a second trial, volunteers wore devices with slabs of bovine and human root dentin. Except for the duration of each intraoral phase, which lasted 2 rather 10 days, the experiment with root dentin run exactly as for enamel. Dental substrates were analyzed for surface microhardness. Two-way ANOVAs (α=0.05) indicated no difference between the microhardness values recorded for human and bovine enamel (p=0.1350), but bovine root dentin had lower microhardness compared to its human counterpart (p=0.0432). While bovine enamel can reliably substitute its human counterpart in in situ dental erosion models, bovine root dentin does not seem to be a viable alternative to the corresponding human tissue.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The aim of this study was to verify whether screw abutment lubrication can generate higher preload values compared to non-lubricated screws, a titanium abutment was screwed onto an implant analog and scanned with the Procera System to generate 20 zirconia abutments. MKIII Brånemark implants were clamped to a precision torque device, and the abutments were distributed in dry and wet groups with 10 specimens each. In the wet groups, the inner threads of the implants were filled with artificial saliva. All abutments were fastened with a Torqtite screw under 32 Ncm. Ten detorque measurements were performed per group pushing the reverse button of the Torque controller soon after screw tightening with values registered. The mean detorque values were calculated and compared by a Student's t test (?=0.05). The wet condition presented significantly higher mean detorque than the dry condition (31.5 ± 1.2 versus 27.5 ± 1.5 Ncm, respectively; p=0.0000024). In conclusion, there was always a loss in the initial torque values when the removal torque was measured under both conditions. The wet condition presented higher mean torque than the dry condition. Better preload values were established in the wet group, suggesting that the abutment screw must be lubricated in saliva to avoid further loosening.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The South Atlantic Magnetic Anomaly (SAMA) is one of the most outstanding anomalies of the geomagnetic field. The SAMA secular variation was obtained and compared to the evolution of other anomalies using spherical harmonic field models for the 1590-2005 period. An analysis of data from four South American observatories shows how this large scale anomaly affected their measurements. Since SAMA is a low total field anomaly, the field was separated into its nondipolar, quadrupolar and octupolar parts. The time evolution of the non-dipole/total, quadrupolar/total and octupolar/total field ratios yielded increasingly high values for the South Atlantic since 1750. The SAMA evolution is compared to the evolution of other large scale surface geomagnetic features like the North and the South Pole and the Siberia High, and this comparison shows the intensity equilibrium between these anomalies in both hemispheres. The analysis of non-dipole fields in historical period suggests that SAMA is governed by (i) quadrupolar field for drift, and (ii) quadrupolar and octupolar fields for intensity and area of influence. Furthermore, our study reinforces the possibility that SAMA may be related to reverse fluxes in the outer core under the South Atlantic region.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

FUNDAMENTO: A ressuscitação de parada cardíaca pode apresentar disfunção miocárdica determinada pelo tempo da isquemia, e a inibição da enzima conversora de angiotensina (ECA) pode reduzir a disfunção cardíaca durante a reperfusão. OBJETIVO: Investigar os efeitos da angiotensina-I e diferentes períodos de isquemia na recuperação funcional em corações de ratos isolados. MÉTODOS: Os corações isolados de ratos Wistar (n = 45; 250-300 g) foram submetidos a diferentes períodos de isquemia global (20, 25 ou 30 min) e reperfundidos (30 min) com o tampão Krebs-Henseleit, ou com a adição de 400 nmol/L de angiotensina-I, ou com 400 nmol/L de angiotensina-I + 100 µmol/L de captopril durante o período de reperfusão. RESULTADOS: A derivada positiva máxima de pressão (+dP/dt max) e o produto frequência-pressão foram reduzidos nos corações expostos à isquemia de 25 min (~ 73%) e à isquemia de 30 min (~ 80%) vs. isquemia de 20 min. A pressão diastólica final do ventrículo esquerdo (PDFVE) e a pressão de perfusão (PP) foram aumentadas nos corações expostos à isquemia de 25 min (5,5 e 1,08 vezes, respectivamente) e à isquemia de 30 min (6 e 1,10 vezes, respectivamente) vs. isquemia de 20 min. A angiotensina-I ocasionou uma diminuição no +dP/dt max e no produto frequência-pressão (~ 85-94%) em todos os períodos de isquemia e um aumento na PDFVE e na PP (6,9 e 1,25 vezes, respectivamente) apenas na isquemia de 20 min. O captopril foi capaz de reverter parcial ou completamente os efeitos da angiotensina-I na recuperação funcional nas isquemias de 20 e 25 min CONCLUSÃO: Os dados sugerem que a angiotensina-II participa direta ou indiretamente no dano pós-isquêmico e que a capacidade de um inibidor da ECA atenuar esse dano depende do tempo de isquemia.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Xylella fastidiosa genome sequencing has generated valuable data by identifying genes acting either on metabolic pathways or in associated pathogenicity and virulence. Based on available information on these genes, new strategies for studying their expression patterns, such as microarray technology, were employed. A total of 2,600 primer pairs were synthesized and then used to generate fragments using the PCR technique. The arrays were hybridized against cDNAs labeled during reverse transcription reactions and which were obtained from bacteria grown under two different conditions (liquid XDM2 and liquid BCYE). All data were statistically analyzed to verify which genes were differentially expressed. In addition to exploring conditions for X. fastidiosa genome-wide transcriptome analysis, the present work observed the differential expression of several classes of genes (energy, protein, amino acid and nucleotide metabolism, transport, degradation of substances, toxins and hypothetical proteins, among others). The understanding of expressed genes in these two different media will be useful in comprehending the metabolic characteristics of X. fastidiosa, and in evaluating how important certain genes are for the functioning and survival of these bacteria in plants.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A simple and fast capillary zone electrophoresis (CZE) method has been developed and validated for quantification of a non-nucleoside reverse transcriptase inhibitor (NNRTI) nevirapine, in pharmaceuticals. The analysis was optimized using 10 mmol L-1 sodium phosphate buffer pH 2.5, +25 kV applied voltage, hydrodynamic injection 0.5 psi for 5 s and direct UV detection at 200 µm. Diazepam (50.0 µg mL-1) was used as internal standard. Under these conditions, nevirapine was analyzed in approximately less than 2.5 min. The analytical curve presented a coefficient of correlation of 0.9994. Limits of detection and quantification were 1.4 µg mL-1 and 4.3 µg mL-1, respectively. Intra- and inter-day precision expressed as relative standard deviations were 1.4% and 1.3%, respectively and the mean recovery was 100.81%. The active pharmaceutical ingredient was subjected to hydrolysis (acid, basic and neutral) and oxidative stress conditions. No interference of degradation products and tablet excipients were observed. This method showed to be rapid, simple, precise, accurate and economical for determination of nevirapine in pharmaceuticals and it is suitable for routine quality control analysis since CE offers benefits in terms of quicker method development and significantly reduced operating costs.