Deep learning models for the automatic analysis of volleyball plays

Collecting and analysing data is an important element in any field of human activity and research. Even in sports, collecting and analyzing statistical data is attracting a growing interest. Some exemplar use cases are: improvement of technical/tactical aspects for team coaches, definition of game strategies based on the opposite team play or evaluation of the performance of players. Other advantages are related to taking more precise and impartial judgment in referee decisions: a wrong decision can change the outcomes of important matches. Finally, it can be useful to provide better representations and graphic effects that make the game more engaging for the audience during the match. Nowadays it is possible to delegate this type of task to automatic software systems that can use cameras or even hardware sensors to collect images or data and process them. One of the most efficient methods to collect data is to process the video images of the sporting event through mixed techniques concerning machine learning applied to computer vision. As in other domains in which computer vision can be applied, the main tasks in sports are related to object detection, player tracking, and to the pose estimation of athletes. The goal of the present thesis is to apply different models of CNNs to analyze volleyball matches. Starting from video frames of a volleyball match, we reproduce a bird's eye view of the playing court where all the players are projected, reporting also for each player the type of action she/he is performing.

Analysis and detection of partial discharges in an electric motor of a hybrid supercar.

The objective of this thesis was the development of a new detection method of partial discharge (PD) activity in the stator of an electrical hybrid supercar fed by a silicon carbide converter, for which detection with common methods make it very difficult to separate PD pulses from switching noise. This work focused on the analysis and detection of partial discharges making use of an antenna, a peak detector, and an oscilloscope capable of capturing the electromagnetic pulses emitted during PD activity. Validation of the proposed method was done by comparing the partial discharge inception voltage (PDIV) detected by this system with the one obtained from an optical method of proven accuracy, with different rise times and samples. Further development of this method, if proved successful on a full stator, can help increasing the overall reliability of the car, potentially allowing for real time detection of PD activity and predictive maintenance before failure of the insulation system in a hybrid vehicle.

Analysis of technological accidents triggered by natural events (Natech) in the perspective of climate change

The severe accidents deriving from the impact of natural events on industrial installations have become a matter of growing concern in the last decades. In the literature, these events are typically referred to as Natech accidents. Several peculiarities distinguish them from conventional industrial accidents caused by internal factors, such as the possible occurrence of multiple simultaneous failures, and the enhanced probability of cascading events. The research project provides a comprehensive overview of Natech accidents that occurred in the Chemical and Process Industry, allowing for the identification of relevant aspects of Natech events. Quantified event trees and probability of ignition are derived from the collected dataset, providing a step forward in the quantitative risk assessment of Natech accidents. The investigation of past Natech accidents also demonstrated that wildfires may cause technological accidents. Climate change and global warming are promoting the conditions for wildfire development and rapid spread. Hence, ensuring the safety of industrial facilities exposed to wildfires is paramount. This was achieved defining safety distances between wildland vegetation and industrial equipment items. In addition, an innovative methodology for the vulnerability assessment of Natech and Domino scenarios triggered by wildfires was developed. The approach accounted for the dynamic behaviour of wildfire events and related technological scenarios. Besides, the performance of the emergency response and the related intervention time in the case of cascading events caused by natural events were evaluated. Overall, the tools presented in this thesis represent a step forward in the Quantitative Risk Assessment of Natech accidents. The methodologies developed also provide a solid basis for the definition of effective strategies for risk mitigation and reduction. These aspects are crucial to improve the resilience of industrial plants to natural hazards, especially considering the effects that climate change may have on the severity of such events.

Mainstreaming of Nature-Based Solutions for the mitigation of hydro-meteorological hazard: governance analysis of a socio- technical change

The Nature-Based Solutions (NBS) concept and approach were developed to simultaneously face challenges such as risk mitigation and biodiversity conservation and restoration. NBSs have been endorsed by major International Organizations such as the EU, the FAO and World Bank that are pushing to enable a mainstreaming process. However, a shift from traditional engineering “grey” solutions to wider and standard adoption of NBS encounters technical, social, cultural, and normative barriers that have been identified with a qualitative content analysis of policy documents, reports and expert interviews. The case of the region Emilia-Romagna was studied by developing an analytical framework that brought together the social-ecological context, the governance system and the characteristics of specific NBSs.

Non-invasive detection of acute cell-mediated graft rejection in paediatric heart transplant recipients: the role of cardiovascular magnetic resonance

Background and Aim: Acute cardiac rejection is currently diagnosed by endomyocardial biopsy (EMB), but multiparametric cardiac magnetic resonance (CMR) may be a non-invasive alternative by its capacity for myocardial structure and function characterization. Our primary aim was to determine the utility of multiparametric CMR in identifying acute graft rejection in paediatric heart transplant recipients. The second aim was to compare textural features of parametric maps in cases of rejection versus those without rejection. Methods: Fifteen patients were prospectively enrolled for contrast-enhanced CMR followed by EMB and right heart catheterization. Images were acquired on a 1,5 Tesla scanner including T1 mapping (modified Look-Locker inversion recovery sequence – MOLLI) and T2 mapping (modified GraSE sequence). The extracellular volume (ECV) was calculated using pre- and post-gadolinium T1 times of blood and myocardium and the patient’s hematocrit. Markers of graft dysfunction including hemodynamic measurements from echocardiography, catheterization and CMR were collated. Patients were divided into two groups based on degree of rejection at EMB: no rejection with no change in treatment (Group A) and acute rejection requiring new therapy (Group B). Statistical analysis included student’t t test and Pearson correlation. Results: Acute rejection was diagnosed in five patients. Mean T1 values were significantly associated with acute rejection. A monotonic, increasing trend was noted in both mean and peak T1 values, with increasing degree of rejection. ECV was significantly higher in Group B. There was no difference in T2 signal between two groups. Conclusion: Multiparametric CMR serves as a noninvasive screening tool during surveillance encounters and may be used to identify those patients that may be at higher risk of rejection and therefore require further evaluation. Future and multicenter studies are necessary to confirm these results and explore whether multiparametric CMR can decrease the number of surveillance EMBs in paediatric heart transplant recipients.

Analysis of human posterior EEG alpha frequency as a function of implicit learning of probabilistic lateralized stimuli in a visual detection task

Alpha oscillatory activity has long been associated with perceptual and cognitive processes related to attention control. The aim of this study is to explore the task-dependent role of alpha frequency in a lateralized visuo-spatial detection task. Specifically, the thesis focuses on consolidating the scientific literature's knowledge about the role of alpha frequency in perceptual accuracy, and deepening the understanding of what determines trial-by-trial fluctuations of alpha parameters and how these fluctuations influence overall task performance. The hypotheses, confirmed empirically, were that different implicit strategies are put in place based on the task context, in order to maximize performance with optimal resource distribution (namely alpha frequency, associated positively with performance): “Lateralization” of the attentive resources towards one hemifield should be associated with higher alpha frequency difference between contralateral and ipsilateral hemisphere; “Distribution” of the attentive resources across hemifields should be associated with lower alpha frequency difference between hemispheres; These strategies, used by the participants according to their brain capabilities, have proven themselves adaptive or maladaptive depending on the different tasks to which they have been set: "Distribution" of the attentive resources seemed to be the best strategy when the distribution probability between hemifields was balanced: i.e. the neutral condition task. "Lateralization" of the attentive resources seemed to be more effective when the distribution probability between hemifields was biased towards one hemifield: i.e., the biased condition task.

Assessment Of Robustness On Analysis Using Headspace Solid-phase Microextraction And Comprehensive Two-dimensional Gas Chromatography Through Experimental Designs.

Plackett-Burman experimental design was applied for the robustness assessment of GC×GC-qMS (Comprehensive Two-Dimensional Gas Chromatography with Fast Quadrupolar Mass Spectrometric Detection) in quantitative and qualitative analysis of volatiles compounds from chocolate samples isolated by headspace solid-phase microextraction (HS-SPME). The influence of small changes around the nominal level of six factors deemed as important on peak areas (carrier gas flow rate, modulation period, temperature of ionic source, MS photomultiplier power, injector temperature and interface temperature) and of four factors considered as potentially influential on spectral quality (minimum and maximum limits of the scanned mass ranges, ions source temperature and photomultiplier power). The analytes selected for the study were 2,3,5-trimethylpyrazine, 2-octanone, octanal, 2-pentyl-furan, 2,3,5,6-tetramethylpyrazine, and 2-nonanone e nonanal. The factors pointed out as important on the robustness of the system were photomultiplier power for quantitative analysis and lower limit of mass scanning range for qualitative analysis.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Flow injection green method for the quantitative analysis of ketoconazole in pharmaceutical preparations

A flow injection method for the quantitative analysis of ketoconazole in tablets, based on the reaction with iron (III) ions, is presented. Ketoconazole forms a red complex with iron ions in an acid medium, with maximum absorbance at 495 nm. The detection limit was estimated to be 1×10--4 mol L-1; the quantitation limit is about 3×10--4 mol L-1 and approximately 30 determinations can be performed in an hour. The results were compared with those obtained with a reference HPLC method. Statistical comparisons were done using the Student's t procedure and the F test. Complete agreement was found at the 0.95 significance level between the proposed flow injection and the HPLC procedures. The two methods present similar precision, i.e., for HPLC the mean relative standard deviation was ca. 1.2% and for FIA ca. 1.6%.

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.