Chemical And Structural Analyses Of Titanium Plates Retrieved From Patients.

The aim of this study was to evaluate the microscopic structure and chemical composition of titanium bone plates and screws retrieved from patients with a clinical indication and to relate the results to the clinical conditions associated with the removal of these devices. Osteosynthesis plates and screws retrieved from 30 patients between January 2010 and September 2013 were studied by metallographic, gas, and energy dispersive X-ray (EDX) analyses and the medical records of these patients were reviewed. Forty-eight plates and 238 screws were retrieved. The time elapsed between plate and screw insertion and removal ranged between 11 days and 10 years. Metallographic analysis revealed that all the plates were manufactured from commercially pure titanium (CP-Ti). The screw samples analyzed consisted of Ti-6Al-4V alloy, except four samples, which consisted of CP-Ti. Titanium plates studied by EDX analysis presented greater than 99.7% titanium by mass. On gas analysis of Ti-6Al-4V screws, three samples were outside the standard values. One CP-Ti screw sample and one plate sample also presented an oxygen analysis value above the standard. The results indicated that the physical properties and chemical compositions of the plates and screws did not correspond with the need to remove these devices or the time of retention.

Reduction Of Oxidative Damage And Inflammatory Response In The Diaphragm Muscle Of Mdx Mice Using Iron Chelator Deferoxamine.

Oxidative stress and inflammatory processes strongly contribute to pathogenesis in Duchenne muscular dystrophy (DMD). Based on evidence that excess iron may increase oxidative stress and contribute to the inflammatory response, we investigated whether deferoxamine (DFX), a potent iron chelating agent, reduces oxidative stress and inflammation in the diaphragm (DIA) muscle of mdx mice (an experimental model of DMD). Fourteen-day-old mdx mice received daily intraperitoneal injections of DFX at a dose of 150 mg/kg body weight, diluted in saline, for 14 days. C57BL/10 and control mdx mice received daily intraperitoneal injections of saline only, for 14 days. Grip strength was evaluated as a functional measure, and blood samples were collected for biochemical assessment of muscle fiber degeneration. In addition, the DIA muscle was removed and processed for histopathology and Western blotting analysis. In mdx mice, DFX reduced muscle damage and loss of muscle strength. DFX treatment also resulted in a significant reduction of dystrophic inflammatory processes, as indicated by decreases in the inflammatory area and in NF-κB levels. DFX significantly decreased oxidative damage, as shown by lower levels of 4-hydroxynonenal and a reduction in dihydroethidium staining in the DIA muscle of mdx mice. The results of the present study suggest that DFX may be useful in therapeutic strategies to ameliorate dystrophic muscle pathology, possibly via mechanisms involving oxidative and inflammatory pathways.

Towards A Deeper Understanding Of Structural Biomass Recalcitrance Using Phase-contrast Tomography.

The development of technological routes to convert lignocellulosic biomass to liquid fuels requires an in-depth understanding of the cell wall architecture of substrates. Essential pretreatment processes are conducted to reduce biomass recalcitrance and usually increase the reactive surface area. Quantitative three-dimensional information about both bulk and surface structural features of substrates needs to be obtained to expand our knowledge of substrates. In this work, phase-contrast tomography (PCT) was used to gather information about the structure of a model lignocellulosic biomass (piassava fibers). The three-dimensional cellular organization of piassava fibers was characterized by PCT using synchrotron radiation. This technique enabled important physical features that describe the substrate piassava fibers to be visualized and quantified. The external surface area of a fiber and internal surface area of the pores in a fiber could be determined separately. More than 96% of the overall surface area available to enzymes was in the bulk substrate. The pore surface area and length exhibited a positive linear relationship, where the slope of this relationship depended on the plant tissue. We demonstrated that PCT is a powerful tool for the three-dimensional characterization of the cell wall features related to biomass recalcitrance. Original and relevant quantitative information about the structural features of the analyzed material were obtained. The data obtained by PCT can be used to improve processing routes to efficiently convert biomass feedstock into sugars.

New Interaction Partners For Nek4.1 And Nek4.2 Isoforms: From The Dna Damage Response To Rna Splicing.

Neks are serine-threonine kinases that are similar to NIMA, a protein found in Aspergillus nidulans which is essential for cell division. In humans there are eleven Neks which are involved in different biological functions besides the cell cycle control. Nek4 is one of the largest members of the Nek family and has been related to the primary cilia formation and in DNA damage response. However, its substrates and interaction partners are still unknown. In an attempt to better understand the role of Nek4, we performed an interactomics study to find new biological processes in which Nek4 is involved. We also described a novel Nek4 isoform which lacks a region of 46 amino acids derived from an insertion of an Alu sequence and showed the interactomics profile of these two Nek4 proteins. Isoform 1 and isoform 2 of Nek4 were expressed in human cells and after an immunoprecipitation followed by mass spectrometry, 474 interacting proteins were identified for isoform 1 and 149 for isoform 2 of Nek4. About 68% of isoform 2 potential interactors (102 proteins) are common between the two Nek4 isoforms. Our results reinforce Nek4 involvement in the DNA damage response, cilia maintenance and microtubule stabilization, and raise the possibility of new functional contexts, including apoptosis signaling, stress response, translation, protein quality control and, most intriguingly, RNA splicing. We show for the first time an unexpected difference between both Nek4 isoforms in RNA splicing control. Among the interacting partners, we found important proteins such as ANT3, Whirlin, PCNA, 14-3-3ε, SRSF1, SRSF2, SRPK1 and hNRNPs proteins. This study provides new insights into Nek4 functions, identifying new interaction partners and further suggests an interesting difference between isoform 1 and isoform 2 of this kinase. Nek4 isoform 1 may have similar roles compared to other Neks and these roles are not all preserved in isoform 2. Besides, in some processes, both isoforms showed opposite effects, indicating a possible fine controlled regulation.

Cerebral Cortex Involvement In Machado-joseph Disease.

Machado-Joseph disease (MJD/SCA3) is the most frequent spinocerebellar ataxia, characterized by brainstem, basal ganglia and cerebellar damage. Few magnetic resonance imaging based studies have investigated damage in the cerebral cortex. The objective was to determine whether patients with MJD/SCA3 have cerebral cortex atrophy, to identify regions more susceptible to damage and to look for the clinical and neuropsychological correlates of such lesions. Forty-nine patients with MJD/SCA3 (mean age 47.7 ± 13.0 years, 27 men) and 49 matched healthy controls were enrolled. All subjects underwent magnetic resonance imaging scans in a 3 T device, and three-dimensional T1 images were used for volumetric analyses. Measurement of cortical thickness and volume was performed using the FreeSurfer software. Groups were compared using ancova with age, gender and estimated intracranial volume as covariates, and a general linear model was used to assess correlations between atrophy and clinical variables. Mean CAG expansion, Scale for Assessment and Rating of Ataxia (SARA) score and age at onset were 72.1 ± 4.2, 14.7 ± 7.3 and 37.5 ± 12.5 years, respectively. The main findings were (i) bilateral paracentral cortex atrophy, as well as the caudal middle frontal gyrus, superior and transverse temporal gyri, and lateral occipital cortex in the left hemisphere and supramarginal gyrus in the right hemisphere; (ii) volumetric reduction of basal ganglia and hippocampi; (iii) a significant correlation between SARA and brainstem and precentral gyrus atrophy. Furthermore, some of the affected cortical regions showed significant correlations with neuropsychological data. Patients with MJD/SCA3 have widespread cortical and subcortical atrophy. These structural findings correlate with clinical manifestations of the disease, which support the concept that cognitive/motor impairment and cerebral damage are related in disease.

Spinal Cord Damage In Machado-joseph Disease.

Machado-Joseph disease (SCA3) is the most frequent spinocerebellar ataxia worldwide and characterized by remarkable phenotypic heterogeneity. MRI-based studies in SCA3 focused in the cerebellum and connections, but little is known about cord damage in the disease and its clinical relevance. To evaluate the spinal cord damage in SCA3 through quantitative analysis of MRI scans. A group of 48 patients with SCA3 and 48 age and gender-matched healthy controls underwent MRI on a 3T scanner. We used T1-weighted 3D images to estimate the cervical spinal cord area (CA) and eccentricity (CE) at three C2/C3 levels based on a semi-automatic image segmentation protocol. The scale for assessment and rating of ataxia (SARA) was employed to quantify disease severity. The two groups-SCA3 and controls-were significantly different regarding CA (49.5 ± 7.3 vs 67.2 ± 6.3 mm(2), p < 0.001) and CE values (0.79 ± 0.06 vs 0.75 ± 0.05, p = 0.005). In addition, CA presented a significant correlation with SARA scores in the patient group (p = 0.010). CE was not associated with SARA scores (p = 0.857). In the multiple variable regression, we found that disease duration was the only variable associated with CA (coefficient = -0.629, p = 0.025). SCA3 is characterized by cervical cord atrophy and antero-posterior flattening. In addition, the spinal cord areas did correlate with disease severity. This suggests that quantitative analyses of the spinal cord MRI might be a useful biomarker in SCA3.

Key Participants Of The Tumor Microenvironment Of The Prostate: An Approach Of The Structural Dynamic Of Cellular Elements And Extracellular Matrix Components During Epithelial-stromal Transition.

Cancer is a multistep process that begins with the transformation of normal epithelial cells and continues with tumor growth, stromal invasion and metastasis. The remodeling of the peritumoral environment is decisive for the onset of tumor invasiveness. This event is dependent on epithelial-stromal interactions, degradation of extracellular matrix components and reorganization of fibrillar components. Our research group has studied in a new proposed rodent model the participation of cellular and molecular components in the prostate microenvironment that contributes to cancer progression. Our group adopted the gerbil Meriones unguiculatus as an alternative experimental model for prostate cancer study. This model has presented significant responses to hormonal treatments and to development of spontaneous and induced neoplasias. The data obtained indicate reorganization of type I collagen fibers and reticular fibers, synthesis of new components such as tenascin and proteoglycans, degradation of basement membrane components and elastic fibers and increased expression of metalloproteinases. Fibroblasts that border the region, apparently participate in the stromal reaction. The roles of each of these events, as well as some signaling molecules, participants of neoplastic progression and factors that promote genetic reprogramming during epithelial-stromal transition are also discussed.

Espécies reativas de oxigênio e de nitrogênio, antioxidantes e marcadores de dano oxidativo em sangue humano: principais métodos analíticos para sua determinação

We review here the chemistry of reactive oxygen and nitrogen species, their biological sources and targets; particularly, biomolecules implicated in the redox balance of the human blood, and appraise the analytical methods available for their detection and quantification. Those biomolecules are represented by the enzymatic antioxidant defense machinery, whereas coadjutant reducing protection is provided by several low molecular weight molecules. Biomolecules can be injured by RONS yielding a large repertoire of oxidized products, some of which can be taken as biomarkers of oxidative damage. Their reliable determination is of utmost interest for their potentiality in diagnosis, prevention and treatment of maladies.

O estado da arte da cromatografia associada à espectrometria de massas acoplada à espectrometria de massas na análise de compostos tóxicos em alimentos

Chromatography combined with several different detection systems is one of the more used and better performing analytical tools. Chromatography with tandem mass spectrometric detection gives highly selective and sensitive analyses and permits obtaining structural information about the analites and about their molar masses. Due to these characteristics, this analytical technique is very efficient when used to detect substances at trace levels in complex matrices. In this paper we review instrumental and technical aspects of chromatography-tandem mass spectrometry and the state of the art of the technique as it is applied to analysis of toxic substances in food.

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Projeto de caixa de madeira para manga (Mangifera Indica L.)

Losses of horticulture product in Brazil are significant and among the main causes are the use of inappropriate boxes and the absence of a cold chain. A project for boxes is proposed, based on computer simulations, optimization and experimental validation, trying to minimize the amount of wood associated with structural and ergonomic aspects and the effective area of the openings. Three box prototypes were designed and built using straight laths with different configurations and areas of openings (54% and 36%). The cooling efficiency of Tommy Atkins mango (Mangifera Indica L.) was evaluated by determining the cooling time for fruit packed in the wood models and packed in the commercially used cardboard boxes, submitted to cooling in a forced-air system, at a temperature of 6ºC and average relative humidity of 85.4±2.1%. The Finite Element Method was applied, for the dimensioning and structural optimization of the model with the best behavior in relation to cooling. All wooden boxes with fruit underwent vibration testing for two hours (20 Hz). There was no significant difference in average cooling time in the wooden boxes (36.08±1.44 min); however, the difference was significant in comparison to the cardboard boxes (82.63±29.64 min). In the model chosen for structural optimization (36% effective area of openings and two side laths), the reduction in total volume of material was 60% and 83% in the cross section of the columns. There was no indication of mechanical damage in the fruit after undergoing the vibration test. Computer simulations and structural study may be used as a support tool for developing projects for boxes, with geometric, ergonomic and thermal criteria.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Structural aspects of the p.P222Q homozygous mutation of HSD3B2 gene in a patient with congenital adrenal hyperplasia

Type II 3β-hydroxysteroid dehydrogenase/Δ5-Δ4-isomerase (3β-HSD2), encoded by the HSD3B2 gene, is a key enzyme involved in the biosynthesis of all the classes of steroid hormones. Deleterious mutations in the HSD3B2 gene cause the classical deficiency of 3β-HSD2, which is a rare autosomal recessive disease that leads to congenital adrenal hyperplasia (CAH). CAH is the most frequent cause of ambiguous genitalia and adrenal insufficiency in newborn infants with variable degrees of salt losing. Here we report the molecular and structural analysis of the HSD3B2 gene in a 46,XY child, who was born from consanguineous parents, and presented with ambiguous genitalia and salt losing. The patient carries a homozygous nucleotide c.665C>A change in exon 4 that putatively substitutes the proline at codon 222 for glutamine. Molecular homology modeling of normal and mutant 3β-HSD2 enzymes emphasizes codon 222 as an important residue for the folding pattern of the enzyme and validates a suitable model for analysis of new mutations.

Comparação entre o dano muscular de flexores do cotovelo e extensores do joelho em idosos= : Muscle damage comparison between elbow flexors and knee extensors in older adults

Universidade Estadual de Campinas . Faculdade de Educação Física

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.