929 resultados para Strain Field Evolution
Resumo:
Systemic lupus erythematosus is an autoimmune disease that causes many psychological repercussions that have been studied through qualitative research. These are considered relevant, since they reveal the amplitude experienced by patients. Given this importance, this study aims to map the qualitative production in this theme, derived from studies of experiences of adult patients of both genders and that had used as a tool a semi-structured interview and/or field observations, and had made use of a sampling by a saturation criterion to determine the number of participants in each study. The survey was conducted in Pubmed, Lilacs, Psycinfo e Cochrane databases, searching productions in English and Portuguese idioms published between January 2005 and June 2012. The 19 revised papers that have dealt with patients in the acute phase of the disease showed themes that were categorized into eight topics that contemplated the experienced process at various stages, from the onset of the disease, extending through the knowledge of the diagnosis and the understanding of the manifestations of the disease, drug treatment and general care, evolution and prognosis. The collected papers also point to the difficulty of understanding, of the patients, on what consists the remission phase, revealing also that this is a clinical stage underexplored by psychological studies.
Resumo:
A proper cast is essential for a successful rehabilitation with implant prostheses, in order to produce better structures and induce less strain on the implants. The aim of this study was to evaluate the precision of four different mold filling techniques and verify an accurate methodology to evaluate these techniques. A total of 40 casts were obtained from a metallic matrix simulating three unit implant-retained prostheses. The molds were filled using four different techniques in four groups (n = 10): Group 1 - Single-portion filling technique; Group 2 - Two-step filling technique; Group 3 - Latex cylinder technique; Group 4 - Joining the implant analogs previously to the mold filling. A titanium framework was obtained and used as a reference to evaluate the marginal misfit and tension forces in each cast. Vertical misfit was measured with an optical microscope with an increase of 120 times following the single-screw test protocol. Strain was quantified using strain gauges. Data were analyzed using one-way ANOVA (Tukey's test) (α =0.05). The correlation between strain and vertical misfit was evaluated by Pearson test. The misfit values did not present statistical difference (P = 0.979), while the strain results showed statistical difference between Groups 3 and 4 (P = 0.027). The splinting technique was considered to be as efficient as the conventional technique. The strain gauge methodology was accurate for strain measurements and cast distortion evaluation. There was no correlation between strain and marginal misfit.
Resumo:
Many Bacillus species can produce biosurfactant, although most of the studies on lipopeptide production by this genus have been focused on Bacillus subtilis. Surfactants are broadly used in pharmaceutical, food and petroleum industry, and biological surfactant shows some advantages over the chemical surfactants, such as less toxicity, production from renewable, cheaper feedstocks and development of novel recombinant hyperproducer strains. This study is aimed to unveil the biosurfactant metabolic pathway and chemical composition in Bacillus safensis strain CCMA-560. The whole genome of the CCMA-560 strain was previously sequenced, and with the aid of bioinformatics tools, its biosurfactant metabolic pathway was compared to other pathways of closely related species. Fourier transform infrared (FTIR) and high-resolution TOF mass spectrometry (MS) were used to characterize the biosurfactant molecule. B. safensis CCMA-560 metabolic pathway is similar to other Bacillus species; however, some differences in amino acid incorporation were observed, and chemical analyses corroborated the genetic results. The strain CCMA-560 harbours two genes flanked by srfAC and srfAD not present in other Bacillus spp., which can be involved in the production of the analogue gramicidin. FTIR and MS showed that B. safensis CCMA-560 produces a mixture of at least four lipopeptides with seven amino acids incorporated and a fatty acid chain with 14 carbons, which makes this molecule similar to the biosurfactant of Bacillus pumilus, namely, pumilacidin. This is the first report on the biosurfactant production by B. safensis, encompassing the investigation of the metabolic pathway and chemical characterization of the biosurfactant molecule.
Resumo:
Trypsins and chymotrypsins are well-studied serine peptidases that cleave peptide bonds at the carboxyl side of basic and hydrophobic l-amino acids, respectively. These enzymes are largely responsible for the digestion of proteins. Three primary processes regulate the activity of these peptidases: secretion, precursor (zymogen) activation and substrate-binding site recognition. Here, we present a detailed phylogenetic analysis of trypsins and chymotrypsins in three orders of holometabolous insects and reveal divergent characteristics of Lepidoptera enzymes in comparison with those of Coleoptera and Diptera. In particular, trypsin subsite S1 was more hydrophilic in Lepidoptera than in Coleoptera and Diptera, whereas subsites S2-S4 were more hydrophobic, suggesting different substrate preferences. Furthermore, Lepidoptera displayed a lineage-specific trypsin group belonging only to the Noctuidae family. Evidence for facilitated trypsin auto-activation events were also observed in all the insect orders studied, with the characteristic zymogen activation motif complementary to the trypsin active site. In contrast, insect chymotrypsins did not seem to have a peculiar evolutionary history with respect to their mammal counterparts. Overall, our findings suggest that the need for fast digestion allowed holometabolous insects to evolve divergent groups of peptidases with high auto-activation rates, and highlight that the evolution of trypsins led to a most diverse group of enzymes in Lepidoptera.
Resumo:
The evolution and population dynamics of avian coronaviruses (AvCoVs) remain underexplored. In the present study, in-depth phylogenetic and Bayesian phylogeographic studies were conducted to investigate the evolutionary dynamics of AvCoVs detected in wild and synanthropic birds. A total of 500 samples, including tracheal and cloacal swabs collected from 312 wild birds belonging to 42 species, were analysed using molecular assays. A total of 65 samples (13%) from 22 bird species were positive for AvCoV. Molecular evolution analyses revealed that the sequences from samples collected in Brazil did not cluster with any of the AvCoV S1 gene sequences deposited in the GenBank database. Bayesian framework analysis estimated an AvCoV strain from Sweden (1999) as the most recent common ancestor of the AvCoVs detected in this study. Furthermore, the analysis inferred an increase in the AvCoV dynamic demographic population in different wild and synanthropic bird species, suggesting that birds may be potential new hosts responsible for spreading this virus.
Resumo:
Avian Pathogenic Escherichia coli (APEC) strains are extra-intestinal E. coli that infect poultry and cause diseases. Nitrite is a central branch-point in bacterial nitrogen metabolism and is used as a cytotoxin by macrophages. Unlike nitric oxide (NO), nitrite cannot diffuse across bacterial membrane cells. The NirC protein acts as a specific channel to facilitate the transport of nitrite into Salmonella and E. coli cells for nitrogen metabolism and cytoplasmic detoxification. NirC is also required for the pathogenicity of Salmonella by downregulating the production of NO by the host macrophages. Based on an in vitro microarray that revealed the overexpression of the nirC gene in APEC strain SCI-07, we constructed a nirC-deficient SCI-07 strain (ΔnirC) and evaluated its virulence potential using in vivo and in vitro assays. The final cumulative mortalities caused by mutant and wild-type (WT) were similar; while the ΔnirC caused a gradual increase in the mortality rate during the seven days recorded, the WT caused mortality up to 24h post-infection (hpi). Counts of the ΔnirC cells in the spleen, lung and liver were higher than those of the WT after 48 hpi but similar at 24 hpi. Although similar number of ΔnirC and WT cells was observed in macrophages at 3 hpi, there was higher number of ΔnirC cells at 16 hpi. The cell adhesion ability of the ΔnirC strain was about half the WT level in the presence and absence of alpha-D-mannopyranoside. These results indicate that the nirC gene influences the pathogenicity of SCI-07 strain.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física