953 resultados para Power Line Detection
Resumo:
The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).
Resumo:
A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
Riboflavin (vitamin B2) is a precursor for coenzymes involved in energy production, biosynthesis, detoxification, and electron scavenging. Previously, we demonstrated that irradiated riboflavin (IR) has potential antitumoral effects against human leukemia cells (HL60), human prostate cancer cells (PC3), and mouse melanoma cells (B16F10) through a common mechanism that leads to apoptosis. Hence, we here investigated the effect of IR on 786-O cells, a known model cell line for clear cell renal cell carcinoma (CCRCC), which is characterized by high-risk metastasis and chemotherapy resistance. IR also induced cell death in 786-O cells by apoptosis, which was not prevented by antioxidant agents. IR treatment was characterized by downregulation of Fas ligand (TNF superfamily, member 6)/Fas (TNF receptor superfamily member 6) (FasL/Fas) and tumor necrosis factor receptor superfamily, member 1a (TNFR1)/TNFRSF1A-associated via death domain (TRADD)/TNF receptor-associated factor 2 (TRAF) signaling pathways (the extrinsic apoptosis pathway), while the intrinsic apoptotic pathway was upregulated, as observed by an elevated Bcl-2 associated x protein/B-cell CLL/lymphoma 2 (Bax/Bcl-2) ratio, reduced cellular inhibitor of apoptosis 1 (c-IAP1) expression, and increased expression of apoptosis-inducing factor (AIF). The observed cell death was caspase-dependent as proven by caspase 3 activation and poly(ADP-ribose) polymerase-1 (PARP) cleavage. IR-induced cell death was also associated with downregulation of v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homologue (avian)/protein serine/threonine kinase B/extracellular signal-regulated protein kinase 1/2 (Src/AKT/ERK1/2) pathway and activation of p38 MAP kinase (p38) and Jun-amino-terminal kinase (JNK). Interestingly, IR treatment leads to inhibition of matrix metalloproteinase-2 (MMP-2) activity and reduced expression of renal cancer aggressiveness markers caveolin-1, low molecular weight phosphotyrosine protein phosphatase (LMWPTP), and kinase insert domain receptor (a type III receptor tyrosine kinase) (VEGFR-2). Together, these results show the potential of IR for treating cancer.
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
FISH has been used as a complement to classical cytogenetics in the detection of mosaicism in sex chromosome anomalies. The aim of this study is to describe three cases in which the final diagnosis could only be achieved by FISH. Case 1 was an 8-year-old 46,XY girl with normal female genitalia referred to our service because of short stature. FISH analysis of lymphocytes with probes for the X and Y centromeres identified a 45,X/46,X,idic(Y) constitution, and established the diagnosis of Turner syndrome. Case 2 was a 21-month-old 46,XY boy with genital ambiguity (penile hypospadias, right testis, and left streak gonad). FISH analysis of lymphocytes and buccal smear identified a 45,X/46,XY karyotype, leading to diagnosis of mixed gonadal dysgenesis. Case 3 was a 47,XYY 19-year-old boy with delayed neuromotor development, learning disabilities, psychological problems, tall stature, small testes, elevated gonadotropins, and azoospermia. FISH analysis of lymphocytes and buccal smear identified a 47,XYY/48,XXYY constitution. Cases 1 and 2 illustrate the phenotypic variability of the 45,X/46,XY mosaicism, and the importance of detection of the 45,X cell line for proper management and follow-up. In case 3, abnormal gonadal function could be explained by the 48,XXYY cell line. The use of FISH in clinical practice is particularly relevant when classical cytogenetic analysis yields normal or uncertain results in patients with features of sex chromosome aneuploidy. Arq Bras Endocrinol Metab. 2012;56(8):545-51
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.
Resumo:
Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.
Resumo:
OBJECTIVE: This in situ study evaluated the discriminatory power and reliability of methods of dental plaque quantification and the relationship between visual indices (VI) and fluorescence camera (FC) to detect plaque. MATERIAL AND METHODS: Six volunteers used palatal appliances with six bovine enamel blocks presenting different stages of plaque accumulation. The presence of plaque with and without disclosing was assessed using VI. Images were obtained with FC and digital camera in both conditions. The area covered by plaque was assessed. Examinations were done by two independent examiners. Data were analyzed by Kruskal-Wallis and Kappa tests to compare different conditions of samples and to assess the inter-examiner reproducibility. RESULTS: Some methods presented adequate reproducibility. The Turesky index and the assessment of area covered by disclosed plaque in the FC images presented the highest discriminatory powers. CONCLUSION: The Turesky index and images with FC with disclosing present good reliability and discriminatory power in quantifying dental plaque.