997 resultados para MONITORAMENTO$$2larpcal


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Este infográfico integra o curso Monitoramento e Avaliação de Serviço de Atenção Domiciliar (2017). Contém o passo a passo para a realização de monitoramento em serviços de saúde.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Behavioral adjustments may occur fast and with less cost than the physiological adaptations. Considering the social behavior is suggestive that the frequency and the intensity of aggressive interactions, the total social cohesion and the extent of vicious attitudes may be used to evaluate welfare. This research presents an analysis of the interactions between the experimental factors such as temperature, genetic and time of the day in the behavior of female broiler breeders under controlled environment in a climatic chamber in order to enhance the different reaction of the birds facing distinct environmental conditions. The results showed significant differences between the behaviors expressed by the studied genetics presenting the need of monitoring them in real-time in order to predict their welfare in commercial housing, due to the complexity of the environmental variables that interfere in the well being process. The research also concluded that the welfare evaluation of female broiler breeders needs to consider the time of the day during the observation of the behaviors.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this work was to compare the soybean crop mapping in the western of Parana State by MODIS/Terra and TM/Landsat 5 images. Firstly, it was generated a soybean crop mask using six TM images covering the crop season, which was used as a reference. The images were submitted to Parallelepiped and Maximum Likelihood digital classification algorithms, followed by visual inspection. Four MODIS images, covering the vegetative peak, were classified using the Parallelepiped method. The quality assessment of MODIS and TM classification was carried out through an Error Matrix, considering 100 sample points between soybean or not soybean, randomly allocated in each of the eight municipalities within the study area. The results showed that both the Overall Classification (OC) and the Kappa Index (KI) have produced values ranging from 0.55 to 0.80, considered good to very good performances, either in TM or MODIS images. When OC and KI, from both sensors were compared, it wasn't found no statistical difference between them. The soybean mapping, using MODIS, has produced 70% of reliance in terms of users. The main conclusion is that the mapping of soybean by MODIS is feasible, with the advantage to have better temporal resolution than Landsat, and to be available on the internet, free of charge.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This paper describes the development of a relational database and a tool for viewing MODIS NDVI temporal profile, using data from MOD09Q1 product, specifically the surface bidirectional reflectance factor relative to the RED and NIR wavelength, mosaic of 8-day temporal composition, and the quality band, in sugarcane fields in the state of São Paulo, for analysis of the late stubble-cane maturation. From sugarcane farms were obtained the historical data about yield, soil, variety, location of the each pixel for each subregion monitored. All data were integrated in a database developed in PostgreSQL. The tool was implemented using Java language and allowed a fast and automatic way of analyzing sugarcane phenological patterns. It concluded that the MODIS NDVI temporal profile using data from MOD09Q1 product is able to subsidize the monitoring of phenological changes in the sugarcane.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The main objective of this work was to evaluate the linear regression between spectral response and soybean yield in regional scale. In this study were monitored 36 municipalities from the west region of the states of Parana using five images of Landsat 5/TM during 2004/05 season. The spectral response was converted in physical values, apparent and surface reflectances, by radiometric transformation and atmospheric corrections and both used to calculate NDVI and GVI vegetation indices. Those ones were compared by multiple and simple regression with government official yield values (IBGE). Diagnostic processing method to identify influents values or collinearity was applied to the data too. The results showed that the mean surface reflectance value from all images was more correlated with yield than individual dates. Further, the multiple regressions using all dates and both vegetation indices gave better results than simple regression.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Twenty-two Triceps brachii muscle obtained from 11 cows aged 3 and 4 years , killed in an experimental slaughter plant, were submitted to mechanical tenderization, injection with acetic acid 0,1M and lactic acid 0,2M, ageing for 9 and 14 days and electrical stimulation (250v - 60Hz - 90s), some of them were reserved as a control group, without treatment. The 14 days ageing time presented 21% of increase in subjective tenderness and 12% of reduction in shear force, these values were similar to the electrical stimulated meat. However the injection with acids and the ageing time 9 days did not present significant effect in the texture. Although the shear force values of mechanical tenderized meat was the shortest among all treatments, suspect of superestimation because of the fractures plan created by this process. Another analyses were carried out: pH reduction curve, R value; colour analysis; weight losses by cooking and by treatment; and microbiological analysis.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Laboratory tests are essential for accurate diagnosis and cost-effective management of thyroid disorders. When the clinical suspicion is strong, hormonal levels just confirms the diagnosis. However, in most patients, symptoms are subtle and unspecific, so that only biochemical tests can detect the disorder. The objective of this article is to do a critical analysis of the appropriate use of the most important thyroid function tests, including serum concentrations of thyrotropin (TSH), thyroid hormones and antithyroid antibodies. Through a survey in the MedLine database, we discuss the major pitfalls and interferences related to daily use of these tests and recommendations are presented to optimize the use of these diagnostic tools in clinical practice.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física