Investigação de Leishmania SP em carrapatos de cães de bairros de Imperatriz-MA, através da Reação em Cadeia da Polimerase (PCR)

A Leishmaniose é uma doença causada pelo protozoário Leishmania sp, podendo acometer homem e animais dependendo da espécie do parasita, São transmitidos pelos flebotomíneos fêmeas, insetos do gênero Lutzomyia, que ao exercer o hematofagismo inoculam as formas promastigota infectantes, mas recentemente, tem sido levantado hipóteses sobre a transmissão por carrapatos. Segundo a vigilância epidemiológica de Imperatriz-MA a cidade é endêmica tanto para Leishmaniose Tegumentar (LT) quanto para a Leishmaniose Visceral (LV). Este trabalho teve como objetivo principal investigar a presença de DNA de Leishmania sp em carrapatos coletados de cães atendidos em petshop e Centro de Controle de Zoonoses do município de Imperatriz utilizando a técnica de PCR. O DNA foi extraído a partir de 640 carrapatos fêmeas e testadas utilizando o primer que amplifica o gene de mini-exon de Leishmania sp. Os carrapatos foram coletados de 41 cães de diferentes bairros da cidade de Imperatriz. A maioria dos carrapatos foram identificados como Rhipicephalus sanguineus. Os seguintes sinais clínicos sugestivos de leishmaniose foram observados nos cães: onicogrifose em 53,65% (22/41); úlceras em 63,41% (26/41), a perda de cabelo e inapetência em 39,02% (16/41). Cento e setenta carrapatos (26,56%) coletados de 16 cães apresentaram DNA de Leishmania do subgênero Viannia, responsável pela forma cutânea da doença. Não foi detectado nenhum DNA de Leishmania infantum chagasi. Carrapatos infectados foram coletados de ambos os cães sintomáticos e assintomáticos. Embora ainda não tenha sido demonstrado que os carrapatos possam transmitir Leishmania aos cães sob condições naturais, o resultado deste estudo tem vários aspectos importantes, pois é um método não-invasivo de detecção, capaz de diferenciar os grupos de parasitas em circulação, em especial se os animais não têm lesões, pode ser um indicador biológico em locais onde não é feito uma investigação sorológica e nem entomológica, podendo dar suporte aos programas de vigilância de saúde local.

Detecção de Cryptosporidium serpentis em amostras fecais de serpentes utilizando PCR em tempo real

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Padronização da reação de trans-splicing in vitro em tripanosomas utilizando a técnica de RT-PCR

Pós-graduação em Biotecnologia - IQ

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Distinct genetic structure in populations of Chrysoperla externa (Hagen) (Neuroptera, Chrysopidae) shown by genetic markers ISSR and COI gene

Distinct genetic structure in populations of Chrysoperla externa (Hagen) (Neuroptera, Chrysopidae) shown by genetic markers ISSR and COI gene. Green lacewings are generalist predators, and the species Chrysoperla externa presents a great potential for use in biological control of agricultural pests due to its high predation and reproduction capacities, as well as its easy mass rearing in the laboratory. The adaptive success of a species is related to genetic variability, so that population genetic studies are extremely important in order to maximize success of the biological control. Thus, the present study used nuclear (Inter Simple Sequence Repeat - ISSR) and mitochondrial (Cytochrome Oxidase I - COI) molecular markers to estimate the genetic variability of 12 populations in the São Paulo State, Brazil, as well as the genetic relationships between populations. High levels of genetic diversity were observed for both markers, and the highest values of genetic diversity appear associated with municipalities that have the greatest areas of native vegetation. There was high haplotype sharing, and there was no correlation between the markers and the geographic distribution of the populations. The AMOVA indicated absence of genetic structure for the COI gene, suggesting that the sampled areas formed a single population unit. However, the great genetic differentiation among populations showed by ISSR demonstrates that these have been under differentiation after their expansion or may also reflect distinct dispersal behavior between males and females.

Detecção do operon ica da produção de biofilme, gene mecA de resistência à oxacilina e identificação de espécies de Staphylococcus spp. diretamente dos frascos de hemoculturas pela técnica de PCR multiplex

Pós-graduação em Doenças Tropicais - FMB

Allele frequency of hereditary equine regional dermal asthenia in American Quarter horses in Brazil determined by quantitative real-time PCR with high resolution melting analysis

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Evaluation of ERIC-PCR as Genotyping Method for Corynebacterium pseudotuberculosis Isolates

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Evaluation of hsp65 Nested PCR-Restriction Analysis (PRA) for Diagnosing Tuberculosis in a High Burden Country

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Multiplex-PCR for differentiation of Mycobacterium bovis from Mycobacterium tuberculosis complex

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Comparison of PCR with stained slides of bone marrow and lymph nodes aspirates with suspect diagnosis for leishmaniasis

Visceral leishmaniasis (VL), also known as kala-azar, is a disseminated protozoan infection caused by Leishmania donovani complex. Traditionally the definite diagnosis is made by amastigote detection in the tissue. The aim this study was to evaluate the PCR technique in stained slides of bone marrow and lymph nodes aspirates with suspect diagnosis for leishmaniasis. Slides were selected totaling 62 suspect cases (33 bone marrow samples and 29 lymph node samples) and 17 positive cases (8 bone marrow and 9 lymph node). From 62 suspect cases, 39 (62.90%) were confirmed to be positive being 17 (n = 29) lymph node aspirates and 22 (n = 33) bone marrow. This finding is in agreement with the higher sensitivity of the PCR assay compared to direct microscopic observation. In conclusion, the findings of this study supports the use of PCR on archive cytological preparation stained slides for the diagnosis of canine visceral leishmaniasis, emphasizing the higher sensitivity of this technique when compared to direct microscopic examination and mostly the use of the suspect status for the cytology samples that presents the previously mentioned particularities with focus on detecting the oligosymptomatic or assymptomatic dogs in endemic areas functioning as potential reservoirs for this disease. (C) 2014 Elsevier B.V. All rights reserved.

The detection of Cryptosporidium serpentis in snake fecal samples by real-time PCR

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Diagnosis of gastric cryptosporidiosis in birds using a duplex real-time PCR assay

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Species-specific PCR for the identification of Cooperia curticei (Nematoda: Trichostrongylidae) in sheep

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)