Effectiveness of the Combined Recombinant Human Growth Hormone and Gonadotropin-Releasing Hormone Analog Therapy in Pubertal Patients with Short Stature due to SHOX Deficiency

Context: Isolated heterozygous SHOX defects are the most frequent monogenic cause of short stature, and combined therapy with recombinant human GH (rhGH) and GnRH analog (GnRHa) in pubertal patients has been suggested, but there are no data on final height. Objective: The aim of the study was to analyze adult height after rhGH and GnRHa therapy in patients with SHOX haploinsufficiency. Patients: Ten peripubertal patients with isolated SHOX defects participated in the study. Intervention: Five patients were followed without treatment, and five were treated with rhGH (50 mu g/kg/d) and depot leuprolide acetate (3.75 mg/month). Main Outcome Measures: Adult height SD score (SDS) was measured. Results: All patients followed without treatment had marked downward growth shift during puberty (height SDS, -1.2 +/- 0.7 at 11.4 +/- 1.4 yr; adult height SDS, -2.5 +/- 0.5). Conversely, four of five patients treated with rhGH for 2 to 4.9 yr associated to GnRHa for 1.4 to 5.8 yr improved their height SDS from -2.3 +/- 1.3 at 11.8 +/- 2.1 yr to a final height SDS of -1.7 +/- 1.6. The difference between the mean height SDS at the first evaluation and final height SDS was statistically significant in nontreated vs. treated patients (mean height SDS change, -1.2 +/- 0.4 vs. 0.6 +/- 0.4, respectively; P < 0.001). Conclusion: A gain in adult height of patients with isolated SHOX defects treated with combined rhGH and GnRHa therapy was demonstrated for the first time, supporting this treatment for children with SHOX defects who have just started puberty to avoid the loss of growth potential observed in these patients during puberty. (J Clin Endocrinol Metab 95: 328-332, 2010)

5 Hz repetitive TMS increases anticipatory motor activity in the human cortex

In the present study, we analyzed how high-frequency repetitive transcranial magnetic stimulation (rTMS) of the primary motor hand area (M1-Hand) shapes anticipatory motor activity in frontal areas as indexed by the contingent negative variation (CNV). Eight right-handed volunteers received real or sham 5 Hz rTMS at an intensity of 90% resting motorthreshold (1500 stimuli per session). Real but not sham rTMS to left M1-Hand induced a site-specific increase in amplitude of the late component of the CNV at the electrode C3 overlaying the site of stimulation. The increase in pre-movement activity in the stimulated cortex may reflect an increase in facilitatory drive from connected motor areas, enhanced responsiveness of the stimulated cortex to these inputs or both. (c) 2005 Elsevier Ireland Ltd. All rights reserved.

Executive "brake failure" following deactivation of human frontal lobe

In the course of daily living, humans frequently encounter situations in which a motor activity, once initiated, becomes unnecessary or inappropriate. Under such circumstances, the ability to inhibit motor responses can be of vital importance. Although the nature of response inhibition has been studied in psychology for several decades, its neural basis remains unclear. Using transcranial magnetic stimulation, we found that temporary deactivation of the pars opercularis in the right inferior frontal gyrus selectively impairs the ability to stop an initiated action. Critically, deactivation of the same region did not affect the ability to execute responses, nor did it influence physiological arousal. These findings confirm and extend recent reports that the inferior frontal gyrus is vital for mediating response inhibition.

In situ immune responses to interstitial pneumonitis in human visceral leishmaniasis

Lung disease during active human visceral leishmaniasis is frequently reported. As such, studies have associated pulmonary symptoms to interstitial pneumonitis with a mononuclear infiltrate. However, the immune response in this condition has never been described before. The aim of this study was to determine the immunophenotypic pattern and cytokine profile of lung involvement (IPL) in human visceral leishmaniasis. Quantitative methods of analysis were performed using immunohistochemistry, and were compared with a control group of normal lung. Interstitial macrophages and cd8 cells were increased in IPL, and IL-4 as well as TNF-alpha displayed increased expression when compared to the control group. This inflammatory process with a Th2 pattern, as suggested by increased IL-4 and low IFN-gamma expression, is consistent with the immune response in other organs of visceral leishmaniasis. The microenvironment of the immune response in this condition is associated with lung disease in patients with interstitial pneumonitis related to visceral leishmaniasis, increasing the chance of bacterial infection.

The expression of TLR9 in human cutaneous leishmaniasis is associated with granuloma

P>The Toll-like receptor (TLR) signalling pathway is the first system that defends against Leishmania. After recognising Leishmania as nonself, TLRs trigger NF-kappa B expression. NF-kappa B proceeds to the nucleus and promotes the transcription of pro-inflammatory cytokines. TLR9 is thus an important factor in the induction of an effective immune response against Leishmania. We examined the pattern of TLR9 expression in 12 patients with cutaneous leishmaniasis caused by Leishmania braziliensis detected by polymerase chain reaction. Normal skin was analysed as a negative control. TLR9 expression was examined in the dermis and epidermis by immunohistochemical analysis of paraffin-embedded biopsy tissue. TLR9 expression was primarily observed in the granuloma. The protein was detected in a few cells in the dermis. A lower expression level was detected in the epidermis of patients with leishmaniasis when compared with normal skin. The presence of TLR9 in the skin of patients with cutaneous leishmaniasis is associated with granuloma and expressed by macrophages.

Biological activity and metabolic clearance of recombinant human follicle stimulating hormone produced in Sp2/0 myeloma cells

Human follicle stimulating hormone is a pituitary glycoprotein that is essential for the maintenance of ovarian follicle development and testicular spermatogenesis. Like other members of the glycoprotein hormone family, it contains a common a subunit and a hormone specific beta subunit. Each subunit contains two glycosylation sites. The specific structures of the oligosaccharides of human follicle stimulating hormone have been shown to influence both the in vitro and in vivo bioactivity. Since the carbohydrate structure of a protein reflects the glycosylation apparatus of the host cells in which the protein is expressed, we examined the isoform profiles, in vitro bioactivity and metabolic clearance of a preparation of purified recombinant human follicle stimulating hormone derived from a stable, transfected Sp2/0 myeloma cell line, and pituitary human follicle stimulating hormone. Isoelectric focussing and chromatofocussing studies of human follicle stimulating hormone preparations both showed a more basic isoform profile for the recombinant human follicle stimulating hormone compared to that of pituitary human follicle stimulating hormone. The recombinant human follicle stimulating hormone had a significantly higher radioreceptor activity compared to that of pituitary human follicle stimulating hormone, consistent with a greater in vitro potency. Pharmacokinetic studies in rats indicated a similar terminal half life (124 min) to that of the pituitary human follicle stimulating hormone (119 min). Preliminary carbohydrate analysis showed recombinant human follicle stimulating hormone to contain high mannose and/or hybrid type, in addition to complex type carbohydrate chains, terminating with both alpha 2,3 and alpha 2,6 linked sialic acids. These results demonstrate that recombinant human follicle stimulating hormone made in the Sp2/0 myeloma cells is sialylated, has a more basic isoform profile, and has a greater in vitro biological potency compared to those of the pituitary human follicle stimulating hormone.

Processing of mutated human proinsulin to mature insulin in the non-endocrine cell line, CHO

Heterologous genes encoding proproteins, including proinsulin, generally produce mature protein when expressed in endocrine cells while unprocessed or partially processed protein is produced in non-endocrine cells. Proproteins, which are normally processed in the regulated pathway restricted to endocrine cells, do not always contain the recognition sequence for cleavage by furin, the endoprotease specific to the constitutive pathway, the principal protein processing pathway in non-endocrine cells. Human proinsulin consists of B-Chain-C-peptide-A-Chain and cleavage at the B/C and C/A junctions is required for processing. The B/C, but not the C/A junction, is recognised and cleaved in the constitutive pathway. We expressed a human proinsulin and a mutated proinsulin gene with an engineered furin recognition sequence at the C/A junction and compared the processing efficiency of the mutant and native proinsulin in Chinese Hamster Ovary cells. The processing efficiency of the mutant proinsulin was 56% relative to 0.7% for native proinsulin. However, despite similar levels of mRNA being expressed in both cell lines, the absolute levels of immunoreactive insulin, normalized against mRNA levels, were 18-fold lower in the mutant proinsulin-expressing cells. As a result, there was only a marginal increase in absolute levels of insulin produced by these cells. This unexpected finding may result from preferential degradation of insulin in non-endocrine cells which lack the protection offered by the secretory granules found in endocrine cells.

Gut ischemia/reperfusion induced acute lung injury is an alveolar macrophage dependent event

Background:. Although the role of the lung alveolar macrophage (AM) as a mediator of acute lung injury (ALI) after lung ischemia/reperfusion (I/R) has been suggested by animal experiments, it has not been determined whether AMs mediate ALI after intestinal I/R. The objective of this study was to determine the effect of AM elimination on ALI after intestinal I/R in rats. Mwthods: Male Wistar rats (n = 90) were randomly divided into three groups: the clodronate-liposomes (CLOD-LIP) group received intratracheal treatment with CLOD-LIP; the liposomes (LIP) group received intratracheal treatment with LIP; and the nontreated (UNTREAT) group received no treatment. Twenty-four hours later each group was randomly divided into three subgroups: the intestinal I/R subgroup was subjected to 45-minute intestinal ischemia and 2-hour reperfusion; the laparotomy (LAP) subgroup was subjected to LAP and sham procedures; the control (CTR) subgroup received no treatment. At the end of reperfusion, ALI was quantitated in all the animals by the Evans blue dye (EBD) method. Results: ALI values are expressed as EBD lung leakage (mu g EBD/g dry lung weight). EBD lung leakage values in the CLOD-LIP group were 32.59 +/- 12.74 for I/R, 27.74 +/- 7.99 for LAP, and 33.52 +/- 10.17 for CTR. In the LIP group, lung leakage values were 58.02 +/- 18.04 for I/R, 31.90 +/- 8.72 for LAP, and 27.17 +/- 11.48 for CTR. In the UNTREAT group, lung leakage values were 55.60 +/- 10.96 for I/R, 35.99 +/- 6.89 for LAP, and 30.83 +/- 8.41 for CTR. Within each group, LAP values did not differ from CTR values. However, in the LIP and UNTREAT groups, values for both the LAP and CTR subgroups were lower than values for the I/R subgroup (p < 0.001). The CLOD-LIP I/R subgroup value was less (p < 0.001) than the I/R subgroup values in the LIP and UNTREAT groups. These results indicated that I/R provokes ALI that can be prevented by CLOD-LIP treatment, and further suggested that AMs are essential for ALI occurrence induced by intestinal I/R in rats.

Mathematical constraints on a theory of human memory - Response

Colonius suggests that, in using standard set theory as the language in which to express our computational-level theory of human memory, we would need to violate the axiom of foundation in order to express meaningful memory bindings in which a context is identical to an item in the list. We circumvent Colonius's objection by allowing that a list item may serve as a label for a context without being identical to that context. This debate serves to highlight the value of specifying memory operations in set theoretic notation, as it would have been difficult if not impossible to formulate such an objection at the algorithmic level.

Reconstruction of large cranial defects in nonimmunosuppressed experimental design with human dental pulp stem cells

The main aim of this study is to evaluate the capacity of human dental pulp stem cells (hDPSC), isolated from deciduous teeth, to reconstruct large-sized cranial bone defects in nonimmunosuppressed (NIS) rats. To our knowledge, these cells were not used before in similar experiments. We performed two symmetric full-thickness cranial defects (5 x 8 mm) on each parietal region of eight NIS rats. In six of them, the left side was supplied with collagen membrane only and the right side (RS) with collagen membrane and hDPSC. In two rats, the RS had collagen membrane only and nothing was added at the left side (controls). Cells were used after in vitro characterization as mesenchymal cells. Animals were euthanized at 7, 20, 30, 60, and 120 days postoperatively and cranial tissue samples were taken from the defects for histologic analysis. Analysis of the presence of human cells in the new bone was confirmed by molecular analysis. The hDPSC lineage was positive for the four mesenchymal cell markers tested and showed osteogenic, adipogenic, and myogenic in vitro differentiation. We observed bone formation 1 month after surgery in both sides, but a more mature bone was present in the RS. Human DNA was polymerase chain reaction-amplified only at the RS, indicating that this new bone had human cells. The us e of hDPSC in NIS rats did not cause any graft. rejection. Our findings suggest that hDPSC is an additional cell resource for correcting large cranial defects in rats and constitutes a promising model for reconstruction of human large cranial defects in craniofacial surgery.

Molecular adjuvant effects of a conformationally biased agonist elf human C5a anaphylatoxin

A conformationally biased decapeptide agonist of human C5a anaphylatoxin (YSFKPMPLaR) was used as a molecular adjuvant in stimulating Ab responses against peptide epitopes derived from human MUC1 glycoprotein and the human mu and kappa opioid receptors. C57BL6 mice were immunized with the MUC1 epitope (YKQGGFLGL); the C5a agonist (YSFKPMPLaR); YSFKPMPLaR and YKQGGFLGL together, but unconjugated; a C5a-active, MUC1 epitope construct (YKQGGFLGLYSFKPMPLaR); and a C5a-inactive, reversed moiety construct (YSFKPMPLaRYKQGGFLGL). High Ab titers specific for the MUC1 epitope were observed Only in mice immunized with the C5a-active epitope construct. Similar results were obtained in BALB/c mice immunized with the C5a-active, MUC1 epitope construct, Abs from the sera of the C57BL6 mice were predominately of the IgG2a, IgC2b, and IgM isotypes and were reactive against human recombinant MUC1 and MUC1 expressed by the Panc-1 M1F.15 pancreatic cell line, When compared with the corresponding KLH-epitope conjugates in C57BL6 mice, the epitope-C5a agonist constructs produced titers of specific IgG Abs of isotypes distinct from those generated by the keyhole limpet hemocyanin-epitope conjugates, Rabbits immunized with a mu opioid receptor epitope-C5a agonist construct (GDLSDPCGNRTNLGGRDSLYSFKPMPLaR) or a kappa opioid receptor epitope-C5a agonist construct (FPGWAEPDSNGSEDAQLYSFKPMPLaR) generated high titer, epitope-specific Ab responses, Ab titers generated in response to the opioid epitope-C5a agonist constructs were comparable to those generated by the opioid KLH-epitope conjugates, The results of this study are discussed in terms of possible mechanisms by which the conformationally biased C5a agonist serves as a molecular adjuvant.

Evaluation of Maxillary Alveolar Reconstruction Using a Resorbable Collagen Sponge with Recombinant Human Bone Morphogenetic Protein-2 in Cleft Lip and Palate Patients

Introduction: A resorbable collagen matrix with recombinant human bone morphogenetic protein (rhBMP-2) was compared with traditional iliac crest bone graft for the closure of alveolar defects during secondary dental eruption. Methods: Sixteen patients with unilateral cleft lip and palate, aged 8 to 12 years, were selected and randomly assigned to group 1 (rhBMP-2) or group 2 (iliac crest bone graft). Computed tomography was performed to assess both groups preoperatively and at months 6 and 12 postoperatively. Bone height and defect volume were calculated through Osirix Dicom Viewer (Pixmeo, Apple Inc.). Overall morbidity was recorded. Results: Preoperative and follow-up examinations revealed progressive alveolar bone union in all patients. For group 1, final completion of the defect with a 65.0% mean bone height was detected 12 months postoperatively. For group 2, final completion of the defect with an 83.8% mean bone height was detected 6 months postoperatively. Dental eruption routinely occurred in both groups. Clinical complications included significant swelling in three group 1 patients (37.5%) and significant donor-site pain in seven group 2 patients (87.5%). Conclusions: For this select group of patients with immature skeleton, rhBMP-2 therapy resulted in satisfactory bone healing and reduced morbidity compared with traditional iliac crest bone grafting.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).