969 resultados para BONE MARROW MONONUCLEAR CELLS
Resumo:
Occupational exposure to benzene is known to cause leukemia, but the mechanism remains unclear. Unlike most other carcinogens, benzene and its metabolites are weakly or nonmutagenic in most simple gene mutation assays. Benzene and its metabolites do, however, produce chromosomal damage in a variety of systems. Here, we have used the glycophorin A (GPA) gene loss mutation assay to evaluate the nature of DNA damage produced by benzene in 24 workers heavily exposed to benzene and 23 matched control individuals in Shanghai, China. The GPA assay identifies stem cell or precursor erythroid cell mutations expressed in peripheral erythrocytes of MN-heterozygous subjects, distinguishing the NN and N phi mutant variants. A significant increase in the NN GPA variant cell frequency (Vf) was found in benzene-exposed workers as compared with unexposed control individuals (mean +/- SEM, 13.9 +/- 1.7 per million cells vs. 7.4 +/- 1.1 per million cells in control individuals; P = 0.0002). In contrast, no significant difference existed between the two groups for the N phi Vf (9.1 +/- 0.9 vs. 8.8 +/- 1.8 per million cells; P = 0.21). Further, lifetime cumulative occupational exposure to benzene was associated with the NN Vf (P = 0.005) but not with the N phi Vf (P = 0.31), suggesting that NN mutations occur in longer-lived bone marrow stem cells. NN variants result from loss of the GPA M allele and duplication of the N allele, presumably through recombination mechanisms, whereas NO variants arise from gene inactivation, presumably due to point mutations and deletions. Thus, these results suggest that benzene produces gene-duplicating mutations but does not produce gene-inactivating mutations at the GPA locus in bone marrow cells of humans exposed to high benzene levels. This finding is consistent with data on the genetic toxicology of benzene and its metabolites and adds further weight to the hypothesis that chromosome damage and mitotic recombination are important in benzene-induced leukemia.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
Trabalho Final do Curso de Mestrado Integrado em Medicina, Faculdade de Medicina, Universidade de Lisboa, 2014
Resumo:
Immunoprophylactic products against neosporosis during pregnancy should induce an appropriately balanced immune response. In this respect, OprI, a bacterial lipoprotein targeting toll like receptor (TLR)2, provides promising adjuvant properties. We report on the manipulation of the innate and the T-cell immune response through the fusion of OprI with the Neospora caninum chimeric protein Mic3-1-R. In contrast to Mic3-1-R, OprI-MIC3-1-R significantly activated bone-marrow dendritic cells from naïve mice. Mice immunized with OprI-Mic3-1-R induced an immune response with mixed T helper (Th)1 and Th2 properties (high levels of both immunoglobulin (Ig)G1 and IgG2a and of interleukin (IL)-10, IL-12(p70) and interferon-γ responses) whereas Mic3-1-R+saponin induced a clear Th2-biased response (low IgG2a and high IL-4 and IL-10). After mating and challenge with N. caninum, increased expression of interferon-γ was only found in placentas from OprI-Mic3-1-R immunized dams. However, no protection against vertical transmission and neonatal mortality was observed in either of the two groups. These results indicated that more exhaustive studies must be done to elucidate the immune mechanisms associated with transplacental transmission. Antigen linkage to TLR2-ligands, such as OprI, is a useful tool to investigate this enigma by reorienting the innate and adaptive immune responses against other candidate antigens in future studies.
Resumo:
Side population (SP) cells in the adult kidney are proposed to represent a progenitor population. However, the size, origin, phenotype, and potential of the kidney SP has been controversial. In this study, the SP fraction of embryonic and adult kidneys represented 0.1 to 0.2% of the total viable cell population. The immunophenotype and the expression profile of kidney SP cells was distinct from that of bone marrow SP cells, suggesting that they are a resident nonhematopoietic cell population. Affymetrix expression profiling implicated a role for Notch signaling in kidney SP cells and was used to identify markers of kidney SP. Localization by in situ hybridization confirmed a primarily proximal tubule location, supporting the existence of a tubular niche, but also revealed considerable heterogeneity, including the presence of renal macrophages. Adult kidney SP cells demonstrated multilineage differentiation in vitro, whereas microinjection into mouse metanephroi showed that SP cells had a 3.5- to 13-fold greater potential to contribute to developing kidney than non-SP main population cells. However, although reintroduction of SP cells into an Adriamycin-nephropathy model reduced albuminuria:creatinine ratios, this was without significant tubular integration, suggesting a humoral role for SP cells in renal repair. The heterogeneity of the renal SP highlights the need for further fractionation to distinguish the cellular subpopulations that are responsible for the observed multilineage capacity and transdifferentiative and humoral activities.
Resumo:
Purpose. The purpose of this study was to investigate the immunogenicity of liposomes containing mannosylated lipid core peptide (manLCP) constructs, both in vitro and in vivo, with or without the addition of the immune stimulating adjuvant Quil A. Methods. Mouse bone marrow dendritic cells (BMDC) were cultured with liposome formulations for 48 h, and the resulting level of BMDC activation was determined by flow cytometry. BMDC pulsed with liposome formulations were incubated with 5,6-carboxyfluoroscein diacetate succinimidyl ester-labeled T cells for 72 h and the resulting T cell proliferation was determined by flow cytometry. To investigate the immunogenicity of formulations in vivo, groups of C57Bl/6J mice were immunized by subcutaneous injection, and the resulting antigen-specific cytotoxic and protective immune responses toward tumor challenge evaluated. Results. Despite being unable to demonstrate the activation of BMDC, BMDC pulsed with liposomes containing manLCP constructs were able to stimulate the proliferation of naive T cells in vitro. However, in vivo only liposomes containing both manLCP and Quil A were able to stimulate a strong antigen-specific cytotoxic immune response. Liposomes containing manLCP and Quil A within the same particle were able to protect against the growth of tumor cells to a similar level as if the antigen was administered in alum with CD4 help. Conclusion. ManLCPs administered in liposomes are able to stimulate strong cytotoxic and protective immune responses if Quil A is also incorporated as an adjuvant.
Resumo:
Previous studies have suggested that incorporating relatively small quantities of titanium dioxide into bioactive glasses may result in an increase in bioactivity and hydroxyapatite formation. The present work therefore investigated the in vitro bioactivity of a titanium doped bioglass and compared the results with 45S5 bioglass. Apatite formation was evaluated for bioglass and Ti-bioglass in the presence and absence of foetal calf serum. Scanning electron microscopy (SEM) images were used to evaluate the surface development and energy dispersive X-ray measurements provided information on the elemental ratios. X-ray diffraction spectra confirmed the presence of apatite formation. Cell viability was assessed for bone marrow stromal cells under direct and indirect contact conditions and cell adhesion was assessed using SEM. © 2014 Springer Science+Business Media.
Resumo:
Les translocations chromosomiques du gène MLL sont connues pour mener au développement de leucémies aiguës. La translocation avec un de ses partenaires de fusion les plus communs, ENL, peut engendrer des leucémies aiguës de plusieurs types différents pour cette même translocation. Une fois la leucémogenèse initiée par la fusion MLL-ENL, son rôle quant au maintien du phénotype leucémique n’est pas encore bien connu à ce jour. Pour mieux comprendre l’importance de MLL-ENL après la leucémogenèse, des cellules souches/progénitrices de sang de cordon ombilical humain purifiées ont ainsi été transduites par un virus exprimant le gène de fusion MLL-ENL bordé par des sites LoxP ainsi que le marqueur eGFP. Ces cellules infectées ont ensuite été injectées dans notre modèle de souris immunodéficientes irradiées et placées sous observation pendant 24 semaines pour voir le développement de leucémies aiguës. Elles ont alors été sacrifiées et les cellules la moelle osseuse et de la rate ont ensuite été analysées par cytométrie en flux pour déterminer si la xénogreffe a engendré une leucémie dans notre modèle ainsi que le phénotype de celle-ci. Les souris injectées par les cellules infectées par le MLL-ENL ont généré uniquement des leucémies lymphoïdes aiguës de type B. Les cellules de ces leucémies primaires isolées ont été par la suite infectées par un lentivirus exprimant la cre-recombinase et le marqueur BFP afin d’exciser le gène MLL-ENL des cellules leucémiques grâce aux sites LoxP. Les cellules ont ensuite été triées pour le marqueur BFP et injectées dans des souris secondaires pour de voir si les cellules leucémiques souches pouvaient toujours régénérer la leucémie. Les conséquences de l’absence de MLL-ENL dans le maintien du phénotype leucémique n’ont cependant pas pu être vérifiées à cause d’une erreur dans la séquence de la cre-recombinase, mais nous avons observé la régénération des leucémies secondaires.
Resumo:
Studies on purified blood dendritic cells (DCs) are hampered by poor viability in tissue culture. We, therefore, attempted to study some of the interactions/relationships between DCs and other blood cells by culturing unseparated peripheral blood mononuclear cell (PBMC) preparations in vitro. Flow cytometric techniques were used to undertake a phenotypic and functional analysis of DCs within the cultured PBMC population. We discovered that both the CD11c(+) and CD11c(-) CD123(hi) DC subsets maintained their viability throughout the 3-day culture period, without the addition of exogenous cytokines. This viability was accompanied by progressive up-regulation of the surface costimulatory (CD40, CD80, CD86) and activation (CMRF-44, CMRF-56, CD83) molecules. The survival and apparent production of DCs in PBMC culture (without exogenous cytokines) and that of sorted DCs (with cytokines) were evaluated and compared by using TruCOUNT analysis. Absolute DC counts increased (for CD123hi and CD11c+ subsets) after overnight culture of PBMCs. Single-cell lineage depletion experiments demonstrated the rapid and spontaneous emergence of new in vitro generated DCs from CD14(+)/CD16(+) PBMC radioresistant precursors, additional to the preexisting ex vivo DC population. Unlike monocyte-derived DCs, blood DCs increased dextran uptake with culture and activation. Finally, DCs obtained after culture of PBMCs for 3 days were as effective as freshly isolated DCs in stimulating an allogeneic mixed leukocyte reaction. (C) 2002 by The American Society of Hematology.
Resumo:
A mononuclear phagocyte derived from B1b cells (B1CDP) has been described. As these cells migrate from the peritoneal cavity to non-specific inflammatory lesion sites and are highly phagocytic via Fc and mannose receptors, their microbicidal ability of these cells was investigated using the Coxiella burnetii cell infection model in vitro. In this report, the pattern of infection and C burnetii phase II survival in B1CDP phagosomes was compared with the pattern of infection of peritoneal macrophages from Xid mice (PM phi) and bone marrow derived macrophages (BMM phi). Infection was assessed by determining the large parasitophorous vacuole formation, the relative focus forming units and the quantification of DAPI (4`,6-diamino-2-phenylindole) fluorescence images acquired by confocal microscopy. When compared to macrophages, B1CDP are more permissive to the bacterial infection and less effective to kill them. Further, results suggest that IL-10 secreted by B1 cells are involved in their susceptibility to infection by C burnetti, since B1CDP from IL-10 KO mice are more competent to control C. burnetii infection than cells from wild type mice. These data contribute further to characterize B1CDP as a novel mononuclear phagocyte. (C) 2008 Elsevier GmbH. All rights reserved.
Resumo:
Purpose: The present study investigated osteointegration of autogenous bone (AB) from calvaria graft associated with osteoblastic cells (OC) in bone defects in rats subjected to daily administration of caffeine. Materials and Methods: Male rats received daily intraperitoneal injection of 1.5% caffeine (0.2 mL/100 g body weight) or saline solution for 30 days. Then they were anesthetized, submitted to the extraction of the upper right incisor, and implanted with AB only and AB + OC. The animals were killed on 7th, 21st, and 42nd days after surgery, and their maxilla were processed for obtaining semiserial sections (5 mu m) stained with hematoxylin and eosin. Through image analysis system, the bone volume and the quality of graft in adjacent areas were estimated. Results: The results showed that in caffeine treatment, the AB + OC graft showed no foreign body and acute inflammatory reactions inside the defect when compared to AB. The histometric results revealed that the association AB + OC produced significant increase (10%-15%) in bone volume in later experimental period (42 days) when compared with saline solution group (P <= 0.01). Conclusions: It was concluded that the association of AB from calvaria + OC demonstrated progressive osteointegration and accelerated the repair of bone defects in animals treated with daily caffeine. (Implant Dent 2011;20:369-373)
Resumo:
The BCR-ABL fusion proteins, b2a2 and b3a2, are potential targets for a beneficial graft-versus-leukemia (GVL) effect after allogeneic stem cell transplantation for chronic myeloid leukemia (CML). This study demonstrates that CD4(+) T cells specific to the b2a2 peptide can be generated from a normal allogeneic stem cell transplant donor after stimulation with monocyte-derived dendritic cells (Mo-DC) using culture conditions applicable to clinical use. Stimulation of donor T-cell enriched mononuclear cells (MNC) with b2a2-pulsed Mo-DC produced approximately 3 x 10(9) b2a2-specific CD4(+) T cells. The CD4(+) T cells were HLA-DR7 restricted. These results confirm that the generation of donor derived b2a2-specific T cells for clinical use is feasible and warrants clinical testing after stem cell transplantation.
Resumo:
Among the various possible embodiements of Advanced Therapies and in particular of Tissue Engineering the use of temporary scaffolds to regenerate tissue defects is one of the key issues. The scaffolds should be specifically designed to create environments that promote tissue development and not merely to support the maintenance of communities of cells. To achieve that goal, highly functional scaffolds may combine specific morphologies and surface chemistry with the local release of bioactive agents. Many biomaterials have been proposed to produce scaffolds aiming the regeneration of a wealth of human tissues. We have a particular interest in developing systems based in nanofibrous biodegradable polymers1,2. Those demanding applications require a combination of mechanical properties, processability, cell-friendly surfaces and tunable biodegradability that need to be tailored for the specific application envisioned. Those biomaterials are usually processed by different routes into devices with wide range of morphologies such as biodegradable fibers and meshes, films or particles and adaptable to different biomedical applications. In our approach, we combine the temporary scaffolds populated with therapeutically relevant communities of cells to generate a hybrid implant. For that we have explored different sources of adult and also embryonic stem cells. We are exploring the use of adult MSCs3, namely obtained from the bone marrow for the development autologous-based therapies. We also develop strategies based in extra-embryonic tissues, such as amniotic fluid (AF) and the perivascular region of the umbilical cord4 (Whartonâ s Jelly, WJ). Those tissues offer many advantages over both embryonic and other adult stem cell sourcess. These tissues are frequently discarded at parturition and its extracorporeal nature facilitates tissue donation by the patients. The comparatively large volume of tissue and ease of physical manipulation facilitates the isolation of larger numbers of stem cells. The fetal stem cells appear to have more pronounced immunomodulatory properties than adult MSCs. This allogeneic escape mechanism may be of therapeutic value, because the transplantation of readily available allogeneic human MSCs would be preferable as opposed to the required expansion stage (involving both time and logistic effort) of autologous cells. Topics to be covered: This talk will review our latest developments of nanostructured-based biomaterials and scaffolds in combination with stem cells for bone and cartilage tissue engineering.
Resumo:
? Introduction ? Bone fracture healing and healing problems ? Biomaterial scaffolds and tissue engineering in bone formation - Bone tissue engineering - Biomaterial scaffolds - Synthetic scaffolds - Micro- and nanostructural properties of scaffolds - Conclusion ? Mesenchymal stem cells and osteogenesis - Bone tissue - Origin of osteoblasts - Isolation and characterization of bone marrow derived MSC - In vitro differentiation of MSC into osteoblast lineage cells - In vivo differentiation of MSC into bone - Factors and pathways controlling osteoblast differentiation of hMSC - Defining the relationship between osteoblast and adipocyte differentiation from MSC - MSC and sex hormones - Effect of aging on osteoblastogenesis - Conclusion ? Embryonic, foetal and adult stem cells in osteogenesis - Cell-based therapies for bone - Specific features of bone cells needed to be advantageous for clinical use - Development of therapeutic biological agents - Clinical application concerns - Conclusion ? Platelet-rich plasma (PRP), growth factors and osteogenesis - PRP effects in vitro on the cells involved in bone repair - PRP effects on osteoblasts - PRP effects on osteoclasts - PRP effects on endothelial cells - PRP effects in vivo on experimental animals - The clinical use of PRP for bone repair - Non-union - Distraction osteogenesis - Spinal fusion - Foot and ankle surgery - Total knee arthroplasty - Odontostomatology and maxillofacial surgery - Conclusion ? Molecular control of osteogenesis - TGF-β signalling - FGF signalling - IGF signalling - PDGF signalling - MAPK signalling pathway - Wnt signalling pathway - Hedgehog signalling - Notch signalling - Ephrin signalling - Transcription factors regulating osteoblast differentiation - Conclusion ? Summary This invited review covers research areas of central importance for orthopaedic and maxillofacial bone tissue repair, including normal fracture healing and healing problems, biomaterial scaffolds for tissue engineering, mesenchymal and foetal stem cells, effects of sex steroids on mesenchymal stem cells, use of platelet-rich plasma for tissue repair, osteogenesis and its molecular markers. A variety of cells in addition to stem cells, as well as advances in materials science to meet specific requirements for bone and soft tissue regeneration by addition of bioactive molecules, are discussed.
Resumo:
We describe herein some immunological properties of human fetal bone cells recently tested for bone tissue-engineering applications. Adult mesenchymal stem cells (MSCs) and osteoblasts were included in the study for comparison. Surface markers involved in bone metabolism and immune recognition were analyzed using flow cytometry before and after differentiation or treatment with cytokines. Immunomodulatory properties were studied on activated peripheral blood mononuclear cells (PBMCs). The immuno-profile of fetal bone cells was further investigated at the gene expression level. Fetal bone cells and adult MSCs were positive for Stro-1, alkaline phosphatase, CD10, CD44, CD54, and beta2-microglobulin, but human leukocyte antigen (HLA)-I and CD80 were less present than on adult osteoblasts. All cells were negative for HLA-II. Treatment with recombinant human interferon gamma increased the presence of HLA-I in adult cells much more than in fetal cells. In the presence of activated PBMCs, fetal cells had antiproliferative effects, although with patterns not always comparable with those of adult MSCs and osteoblasts. Because of the immunological profile, and with their more-differentiated phenotype than of stem cells, fetal bone cells present an interesting potential for allogeneic cell source in tissue-engineering applications.