Lingüística textual: quo vadis?

This paper aims to discuss the future -- and the proper survival of Textlinguistics this millenium, and the challenges it has to face in order to contribute to the development of Human Sciences in a new era.

Variação sazonal da fotossíntese, condutância estomática e potencial da água na folha de laranjeira 'Valência'

Seasonal variation in environmental conditions may influence gas exchange rates as well as water relations in perennial species. This work was carried out to evaluate photosynthetic rates (A), transpiration (E), stomatal conductance (g) and leaf water potential (psi f ) in 'Valencia' orange trees grafted on four different rootstocks. Measurements were made twice a day: from 9h00 to 11h00 a.m. and from 1h00 to 3h00 p.m., during January, March and July. A and g were significantly lower and psif was significantly more negative, in the afternoon. The decrease in A may be related to the reduction in g, due to the increase in the vapor pressure deficit between the air and the leaf (VPDair-leaf ) in the afternoon, when temperatures are higher. In spite of the partial stomatal closure in the afternoon, the values for E were approximately the same as those measured in the morning, due to the increase in the VPDair-leaf . A decrease in A and g could also be noted from January to July, that is, from the hot and humid summer months, to the colder and drier winter ones. It was suggested that the decrease in A and g observed from January through March, may be related to the decrease in plant growth rates, which could have influenced the source-sink relationships, since the climatic conditions for both months were similar. The decrease in A and g showed in July, seems to be related to the decrease in both the night temperature and the growth rate of plants.

Ocorrência de fungos filamentosos termo-resistentes em polpa de tomate envasada assepticamente

This work aimed at determining the occurrence of heat resistant molds during the aseptic processing of tomato pulp (8° BRIX). During tomato harvest, 9 lots were sampled (3 at the beginning, 3 at the apex and 3 at the end of harvest) and other 5 lots were sampled between harvest. For each lot, the enumeration of heat resistant molds was carried out in samples collected during the aseptic process. The mean count of heat resistant molds was relatively low, ranging from <1 to 8CFU/100mL of sample. The higher counts were observed in the raw material and the pre-wash and transportation water. Fifty strains of heat resistant molds detected in the enumeration procedure were isolated, codified and stocked. One-month-old spores of each isolate were submitted to different heat shocks to select the most heat resistant mold. The most heat resistant isolated strain (survived 100° C/25 minutes) was identified as Neosartorya fischeri.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Politetrafluoroetileno e esclera humana no tratamento cirúrgico de perfuração escleral em coelhos

Purpose: An experimental study to evaluate the behavior of polytetrafluoroethylene (Gore-Tex®) compared with human sclera, in scleral perforations induced in rabbits eyes was performed. Methods: Twenty-two eyes of rabbits were submitted to scleral perforation followed by Gore-Tex® graft in the left eye and human sclera graft in the right eye respectively. During one month the postoperative evolution was analyzed every day: intensity of hyperemia, presence of infection, secretion, rejection and tonicity of the eyes. Results: No cases of secretion, infection or rejection were observed. The histological sections showed fibrosis in the eyes with Gore-Tex®, good adhesion and epithelization. Conclusion: The Gore-Tex® showed to be a plausible material to be used as graft in scleral defects with some advantages such as easy obtention, good handling and durability.

Eficácia na utilização de córneas no transplante penetrante

PURPOSES: 1) To verify the impact of the creation of the Single Technical Record (STR) at the University of Campinas (Unicamp) Hospital das Clínicas, on the preservation period of corneas which were used in elective penetrating keratoplasties, and 2) to compare the primary failure incidence in cornea penetrating keratoplasties regarding the periods before and after the creation of STR. METHODS: A retrospective study was conducted at the Unicamp Hospital, which evaluated 15 consecutive cornea penetrating keratoplasties between January 1st and April 30th, 2000 and 24 consecutive penetrating keratoplasties between May 1st and September 20th of the same year (corneas under the control of the STR), totaling 39 keratoplasties. RESULTS: The mean time between cornea preparation and transplantation was 3.8 days (±1.78) in the period before STR creation, and 6.0 days (±2.97) after STR creation, representing a 36.7% increase in the preservation time. There was a statistically significant difference (p=0.02) between the two groups. No corneal primary failure was observed among the 39 transplanted patients in both groups. CONCLUSION: Based on the results of this study, it can be concluded that this new concept of the State Transplantation System has caused a statistically significant increase in the conservation period of corneas, which may reduce the period of a clear transplant due to an increased loss of endothelial cells, as well as increase the primary failure incidence or result in a high number of corneas that cannot be used due to having exceeded the preservation time recommended by the literature.

Rehabilitation of severely resorbed edentulous mandible using the modified visor osteotomy technique

The prosthetic rehabilitation of an atrophic mandible is usually unsatisfactory due to the lack of support tissues, mainly bone and keratinized mucosa for treatment with osseointegrated implants or even conventional prosthesis. The prosthetic instability leads to social and functional limitations and chronic physical trauma decreasing the patient's quality of life. A 53-year-old female patient sought care at our surgical service complaining of impairment of her masticatory function associated with the instability of the lower total prosthetic denture. The clinical and complementary exams revealed edentulism in both arches, while the mandibular arch presented severe reabsorption resulting in denture instability and chronic trauma to the oral mucosa. The proposed treatment plan consisted in the mandibular rehabilitation with osseointegrated implants and fixed Brånemark's protocol prosthesis after mandibular reconstruction applying the modified visor osteotomy technique. The proposed technique offered predictable results for reconstruction of the severely resorbed edentulous mandible and posterior rehabilitation with osseointegrated implants.

Immediate implants placed into infected sockets: a case report with 3-year follow-up

The esthetics and functional integrity of the periodontal tissue may be compromised by dental loss. Immediate implants became a viable option to maintain the periodontal architecture because of their anatomic compatibility with the dental socket and the possibility of eliminating local contamination. This article describes the procedure of immediate implant placement in the anterior maxilla replacing teeth with chronic periapical lesions, which were condemned due to endodontic lesions persisting after failed endodontic treatment and endodontic surgery, and discusses the relationship between the procedure and periapical lesions. Surgical removal of hopeless teeth 11, 12 and 21 was performed conservatively in such a way to preserve the anatomy and gingival esthetics. A second surgical access was gained at the apical level, allowing the debridement of the surgical chamber for elimination of the periapical lesion, visual orientation for setting of the implants and filling of the surgical chamber with xenogenous bovine bone graft. After this procedure, the bone chamber was covered with an absorbent membrane and the healing screws were positioned on the implants. Later, a provisional partial removable denture was installed and the implants were inserted after 6 months. After 3 years of rehabilitation, the implants present satisfactory functional and esthetic conditions, suggesting that immediate implant placement combined with guided bone regeneration may be indicated for replacing teeth lost due to chronic periapical lesions with endodontic failure history in the anterior maxilla.

Comparative study of two autogenous graft techniques using piezosurgery for sinus lifting

PURPOSE: Maxillary sinus lifting is a technique, in which, a possible complication is sinus membrane perforation. The aim of this study was to compare two techniques using ultrasound surgery to perform autogenous graft for maxillary sinus lifting. METHODS: Ten rabbits were used in the study, one of them did not undergo surgery. The other nine rabbits had their maxillary sinuses filled with autogenous bone grafts collected from the external skull diploe in particulate form on the right side, and shaved on the left side, both with ultrasonic device. Data on bone density in left and right maxillary sinus, obtained by computed tomography in transverse and longitudinal sections, recorded 90 days after the grafts, were statistically compared. RESULTS: There were no statistically significant differences between the two techniques that used shaved and particulate bone collected by means of ultrasonic device from rabbit skulls. CONCLUSION: Assessment of operative procedures led to the conclusion that piezoelectric ultrasound was shown to be a safe tool in the surgical approach to the maxillary sinus of rabbits, allowing sinus membrane integrity to be maintained during surgical procedures.

Repair of critical-size defects with autogenous periosteum-derived cells combined with bovine anorganic apatite/collagen: an experimental study in rat calvaria

The aim of this study was to evaluate the bone repair using autogenous periosteum-derived cells (PDC) and bovine anorganic apatite and collagen (HA-COL). PDC from Wistar rats (n=10) were seeded on HA-COL discs and subjected to osteoinduction during 6 days. Critical-size defects in rat calvarias were treated with blood clot (G1), autogenous bone (G2), HA-COL (G3) and HA-COL combined with PDC (G4) (n=40), and then analyzed 1 and 3 months after surgeries. Radiographic analysis exhibited no significant temporal change. G1 and G2 had discrete new marginal bone, but the radiopacity of graft materials in G2, G3 and G4 impaired the detection of osteogenesis. At 3 months, histopathological analysis showed the presence of ossification islets in G1, which was more evident in G2, homogeneous new bone around HA-COL in G3 and heterogeneous new bone around HA-COL in G4 in addition to moderate presence of foreign body cells in G3 and G4. Histomorphometric analysis showed no change in the volume density of xenograft (p>0.05) and bone volume density in G2 was twice greater than in G1 and G4 after 3 months (p<0.05), but similar to G3. The PDC did not increase bone formation in vivo, although the biomaterial alone showed biocompatibility and osteoconduction capacity.

Alterações bucais e cuidados orais no paciente transplantado de medula óssea

Os cuidados gerais relativos ao paciente submetido ao transplante de medula óssea (TMO) incluem avaliações odontológicas rotineiras, as quais devem estar inseridas em um contexto multiprofissional. A cavidade oral constitui um sítio propício a infecções com grande potencial de desenvolvimento de bacteremia, sendo que lesões infecciosas devem ser previamente tratadas e controladas pelo cirurgião-dentista. O objetivo desta revisão é discutir questões em destaque na literatura nacional e internacional referentes aos quadros inflamatórios e infecciosos orais de importância para o paciente transplantado de medula óssea, tanto os predisponentes a complicações durante o transplante, quanto os que ocorrem durante e após a terapia mielossupressora. Destaca-se na literatura a doença periodontal avançada, a qual constitui um quadro infeccioso crônico que deve ser evitado ou controlado durante o TMO, principalmente devido à presença de S. viridans. Os fatores de risco para mucosite oral (OM), doença do enxerto contra o hospedeiro (DECH) e xerostomia ainda não estão definidos, principalmente para OM e DECH. São citadas na literatura alternativas promissoras de tratamento para OM, tais como crioterapia, administração de fatores de crescimento e laserterapia. O risco aumentado de cárie é controverso e, dentre as lesões fúngicas e virais, destacam-se as infecções orais e de orofaringe por Candida e pela família de herpesvírus, de importância clínica considerável. Em pacientes pediátricos são relevantes as alterações craniofaciais e dentárias, decorrentes principalmente da radioterapia.

Morfologia e funcionalidade do pneumócito tipo II e sua relação e variação com a idade gestacional em bovinos

Este estudo objetivou caracterizar a presença de pneumócitos tipo II e o início da produção de lipoproteína surfactante em bovinos, correlacionando a idade gestacional com a síntese de surfactante durante o desenvolvimento fetal. Pulmões de fetos com quatro meses de idade gestacional estavam na fase canalicular de desenvolvimento, sem a presença de pneumócitos tipo II ou bandas eletroforéticas compatíveis com a presença de proteínas surfactante. No 5&deg; mês gestacional, os pulmões dos fetos encontravam-se em fase de saculação terminal, com a presença de alvéolos por epitélio cúbico, com áreas formadas por pneumócitos I e II. Nesse período ainda não foi possível identificar proteína surfactante nos pulmões. Esses órgãos em fetos com seis meses de idade gestacional estavam em fase de saco terminal, com presença de pneumócitos tipo I e II. Nessa fase a análise para determinação protéica do surfactante de feto bovino (SDS - PAGE) demonstrou presença de bandas entre 26 e 36kDa, confirmando produção de SP - A, proteína surfactante encontrada em maior quantidade. A partir do 7&deg; mês gestacional, a fase de saco terminal é mais evidente e complexa, com desenvolvimento de intensa vascularização. O pneumócito tipo I apresentava aspecto mais pavimentoso, e o tipo II apresentava aspecto mais globoso. Na análise SDS - PAGE do lavado bronco - alveolar, bandas de proteína surfactante com aspecto similar ao de animais recém-nascidos foram encontradas. Em recém-nascidos, pulmões na fase alveolar foram observados com pneumócitos tipo I e II característicos. O perfil das bandas do lavado bronco-alveolar dos recém-nascidos foi igual ao de animais adultos. Esses achados sugerem que um animal nascido precocemente, a partir dos sete meses de gestação, teria sua sobrevivência garantida devido a uma possível funcionalidade do sistema respiratório do feto, pois o pulmão possuiria as características necessárias para a síntese de proteínas surfactantes. Entretanto, mais estudos clínicos sobre a funcionalidade do sistema respiratório abrem novas fronteiras de experimentos sobre fisiologia respiratória em recém-nascidos bovinos.

The role of pH on the survival of rumen protozoa in steers

In order to study the effect of pH on defaunation in the rumen, four rumen fistulated steers were fed a basal roughage diet for a 4-week adaptation period followed by 17 weeks of feeding with three diets and two feeding levels of high concentrate diet. Rumen outflow fluid rate was evaluated in both ration levels. Rumen protozoa population was monitored weekly and when animals became defaunated, protozoa were reinoculated with rumen contents from one of the faunated steers. At every two weeks, during all the experimental period, rumen pH was measured in all animals at 0, 4, 8 and 12 h after feeding. It was observed an individual animal influence on the establishment and maintenance of the rumen ciliate protozoa population. In all sampling times, mean rumen pH values were higher in faunated steers than in the defaunated ones. No differences were observed in rumen outflow fluid rates between the two ration levels. Extended periods of low rumen pH are probably more detrimental to the survival of ciliate protozoa in the rumen than other factors.

Induced spawning of the endangered Neotropical species Steindachneridion parahybae (Siluriformes: Pimelodidae)

The "surubim do Paraíba" (Steindachneridion parahybae) is a freshwater catfish endemic to the Paraíba do Sul River basin, Brazil. This species has been seriously threatened by environmental disturbances in the last several decades. Wild Steindachneridion parahybae males and females were collected in 2003 and taken to the hatchery of a power plant of the Companhia Energética de São Paulo (CESP). Steindachneridion parahybae broodstocks were artificially induced to reproduce in December 2003 using a combination of carp pituitary extract (CPE) and human chorionic gonadotropin (hCG). Oocytes and milt were stripped; the fertilized eggs were transferred to 60-liter conical incubators and hatched larvae distributed in nine horizontal trays. Exogenous feed was started just after yolk sac absorption. A high rate of cannibalism and photophobia were observed during the larval period, resulting in a 26% survival rate from larvae to fingerlings.

Effects of temperature and salinity on the survival rates of coxicerberus ramosae (Albuquerque, 1978), an interstitial isopod of a Sandy Beach on the coast of Brazil

The tolerance to the combined effects of temperature and salinity was investigated in the interstitial isopod Coxicerberus ramosae (Albuquerque, 1978), a species of intertidal zone of sandy beaches in Rio de Janeiro, Brazil. The animals were collected on Praia Vermelha Beach. The experiments lasted 24 h and nine salinities and seven temperatures were used for a total of 63 combinations. Thirty animals were tested in each combination. The species showed high survival in most of the combinations. The temperature of 35 ºC was lethal and at 5 ºC, the animals tolerated only a narrow range of salinities. The statistical analyses showed that the effects of temperature and salinity were significant on the survival, which confirmed the euryhalinity and eurythermy of this species.