948 resultados para fluorescent PCR
Resumo:
Salmonelose é a infecção bacteriana de origem alimentar mais freqüente no Paraná, Brasil, e os surtos estão associados, principalmente, ao consumo de ovos, carne de aves e derivados. Os objetivos deste trabalho foram identificar os sorovares de Salmonella isolados de carcaças de frango e caracterizá-los molecularmente por REP e ERIC-PCR, assim como identificar os fagotipos de Salmonella Enteriditis. Dos 25 isolados de Salmonella spp. analisados, 18 foram identificados como Enteriditis, 4 como Braenderup, 2 como Worthington e 1 como infantis. Dos 18 isolados de Enteriditis, 14 foram PT4, 2 PT4a, 1 PT7 e 1 RDNC, por se tratar de colônia rugosa. REP-PCR forneceu padrão eletroforético distinto de 10 a 13 bandas distribuídas entre 120 e 2072 pb para cada sorovar diferente testado. A ERIC-PCR mostrou um padrão de 4 a 5 bandas entre 180 e 1000 pb e foi menos discriminativa quando comparada à REP-PCR. Os resultados encontrados confirmaram que a fagotipagem é uma ferramenta útil e discriminativa para o sorovar Enteriditis. Apesar do pequeno número de sorovares testados, os resultados sugerem que a REP-PCR parece ser um método atrativo a ser utilizado no futuro para a discriminação preliminar de sorovares de Salmonella.
Resumo:
The increasing presence of products derived from genetically modified (GM) plants in human and animal diets has led to the development of detection methods to distinguish biotechnology-derived foods from conventional ones. The conventional and real-time PCR have been used, respectively, to detect and quantify GM residues in highly processed foods. DNA extraction is a critical step during the analysis process. Some factors such as DNA degradation, matrix effects, and the presence of PCR inhibitors imply that a detection or quantification limit, established for a given method, is restricted to a matrix used during validation and cannot be projected to any other matrix outside the scope of the method. In Brazil, sausage samples were the main class of processed products in which Roundup Ready® (RR) soybean residues were detected. Thus, the validation of methodologies for the detection and quantification of those residues is absolutely necessary. Sausage samples were submitted to two different methods of DNA extraction: modified Wizard and the CTAB method. The yield and quality were compared for both methods. DNA samples were analyzed by conventional and real-time PCR for the detection and quantification of Roundup Ready® soybean in the samples. At least 200 ng of total sausage DNA was necessary for a reliable quantification. Reactions containing DNA amounts below this value led to large variations on the expected GM percentage value. In conventional PCR, the detection limit varied from 1.0 to 500 ng, depending on the GM soybean content in the sample. The precision, performance, and linearity were relatively high indicating that the method used for analysis was satisfactory.
Resumo:
Coffee is one of the most appreciated drinks in the world. Coffee ground is obtained from the fruit of a small plant that belongs to the genus Coffea. Coffea arabica and Coffea canephora robusta are the two most commercially important species. They are more commonly known as arabica and robusta, respectively. Two-thirds of Coffea arabica plants are grown in South and Central America, and Eastern Africa - the place of origin for this coffee species. Contamination by microorganisms has been a major matter affecting coffee quality in Brazil, mainly due to the harvesting method adopted. Brazilian harvests are based on fruits collected from the ground mixed with those that fall on collection cloths. As the Bacillus cereus bacterium frequently uses the soil as its environmental reservoir, it is easily capable of becoming a contaminant. This study aimed to evaluate the contamination and potential of B. cereus enterotoxin genes encoding the HBL and NHE complexes, which were observed in strains of ground and roasted coffee samples sold in Rio de Janeiro. The PCR (Polymerase Chain Reaction) results revealed high potential of enterotoxin production in the samples. The method described by Speck (1984) was used for the isolation of contaminants. The investigation of the potential production of enterotoxins through isolates of the microorganism was performed using the B. cereus enterotoxin Reverse Passive Latex Agglutination test-kit (BCET-RPLA, Oxoid), according to the manufacturer's instructions. The potential of enterotoxin production was investigated using polymerase chain reaction (PCR) methods for hblA, hblD and hblC genes (encoding hemolysin HBL) and for nheA, nheB and nheC genes (encoding non-hemolytic enterotoxin - NHE). Of all the 17 strains, 100% were positive for at least 1 enterotoxin gene; 52.9% (9/17) were positive for the 3 genes encoding the HBL complex; 35.3% (6/17) were positive for the three NHE encoding genes; and 29.4% (5/17) were positive for all enterotoxic genes.
Resumo:
The enterotoxigenic species Staphylococcus aureus, S. hyicus and S. intermedius show very similar characteristics, making their identification through conventional microbiological methods difficult. This study aimed at the development of a Multiplex PCR (mPCR) for the identification of S. aureus, S. intermedius and S. hyicus using the nuc gene as the target sequence. The results obtained suggest that the set of primers used was specific for the three species of Staphylococcus evaluate with a detection limit of 10² CFU.mL-1.
Resumo:
The DNA extraction is a critical step in Genetically Modified Organisms analysis based on real-time PCR. In this study, the CTAB and DNeasy methods provided good quality and quantity of DNA from the texturized soy protein, infant formula, and soy milk samples. Concerning the Certified Reference Material consisting of 5% Roundup Ready® soybean, neither method yielded DNA of good quality. However, the dilution test applied in the CTAB extracts showed no interference of inhibitory substances. The PCR efficiencies of lectin target amplification were not statistically different, and the coefficients of correlation (R²) demonstrated high degree of correlation between the copy numbers and the threshold cycle (Ct) values. ANOVA showed suitable adjustment of the regression and absence of significant linear deviations. The efficiencies of the p35S amplification were not statistically different, and all R² values using DNeasy extracts were above 0.98 with no significant linear deviations. Two out of three R² values using CTAB extracts were lower than 0.98, corresponding to lower degree of correlation, and the lack-of-fit test showed significant linear deviation in one run. The comparative analysis of the Ct values for the p35S and lectin targets demonstrated no statistical significant differences between the analytical curves of each target.
Resumo:
To investigate microbial diversity and identify spoilage bacteria in fresh pork sausages during storage, twelve industrial pork sausages of different trademarks were stored at 4 ºC for 0, 14, 28 and 42 days, 80% relative humidity and packaged in sterile plastic bags. Microbiological analysis was performed. The pH and water activity (a w) were measured. The culture-independent method performed was the Polymerase Chain Reaction - Denaturing Gradient Gel Electrophoresis (PCR-DGGE). The culture-dependent method showed that the populations of mesophilic bacteria and Lactic Acid Bacteria (LAB) increased linearly over storage time. At the end of the storage time, the average population of microorganisms was detected, in general, at the level of 5 log cfu g-1. A significant (P < 0.005) increase was observed in pH and a w values at the end of the storage time. The PCR-DGGE allowed a rapid identification of dominant communities present in sausages. PCR-DGGE discriminated 15 species and seven genera of bacteria that frequently constitute the microbiota in sausage products. The most frequent spoilage bacteria identified in the sausages were Lactobacillus sakei and Brochothrix thermosphacta. The identification of dominant communities present in fresh pork sausages can help in the choice of the most effective preservation method for extending the product shelf-life.
Resumo:
The physiochemical and biological properties of honey are directly associated to its floral origin. Some current commonly used methods for identification of botanical origin of honey involve palynological analysis, chromatographic methods, or direct observation of the bee behavior. However, these methods can be less sensitive and time consuming. DNA-based methods have become popular due to their simplicity, quickness, and reliability. The main objective of this research is to introduce a protocol for the extraction of DNA from honey and demonstrate that the molecular analysis of the extracted DNA can be used for its botanical identification. The original CTAB-based protocol for the extraction of DNA from plants was modified and used in the DNA extraction from honey. DNA extraction was carried out from different honey samples with similar results in each replication. The extracted DNA was amplified by PCR using plant specific primers, confirming that the DNA extracted using the modified protocol is of plant origin and has good quality for analysis of PCR products and that it can be used for botanical identification of honey.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Maize seeds, infected by Stenocarpella species, are important sources of inoculum for the introduction and dissemination of stalk and ear rot and macrospore leaf spot diseases. The use of healthy seeds is an important strategy for the preventive control of these diseases. However, one of the difficulties in the health quality control programs for maize seeds is the availability of a reliable and quick method for detecting these fungi during routine seed analyses. Therefore, the objective of the present study was to investigate the possibility of using the PCR technique as an alternative method for accurately detecting these pathogens in maize seed samples. Maize seeds were kept in contact with S. maydis colonie developed in PDA media containing mannitol at -1.4 MPa for 72 h. The seed samples used in this study were prepared with infected seeds at incidences of 100, 20, 10, 2, 1 and zero %.The primers used were able to detect S. maydis fungi in association with seeds with a maximum of 2% , however those primers were not able to differentiate between the two species.
Resumo:
To further understand in vivo localization and trafficking of a-tocopherol (a-Toe), the most biologically active form of vitamin E, between lipid environments, tocopherols are required that can be followed by teclu1iques such as confocal microscopy and fluorescence resonance energy transfer (FRET) assays. To this end, sixteen fluorescent analogues of a-tocopherol (la-d [(1)anthroy loxy -a-tocopherols, A O-a-Toes], 2a-d [w-nitro benzoxadiazole-a-tocopherols, NBD-aToes], 3a-d [w-dansyl-a-tocopherols, DAN-a-Toes], and 4a-d [w-N-methylanthranilamide-atocopherols, NMA-a-TocsD were prepared by substituting fluorescent labels at the terminus of w-functionalized alkyl chains extending from C-2 of the chroman ring while retaining key binding features of the natural ligand. These compounds were prepared starting from (S)-Trolox® acid VIa esterification, protection, and reduction producing the silyl-protected (S)-Trolox aldehyde that was coupled using Wittig chemistry to different w-hydroxyalkylphosphonium bromides. Reduction of the alkene generated the w-hydroxy functionalized 2-n-alkyl intermediates 9a-d having the necessary 2R stereochemistry. A series of functional group manipulations including mesylation, substitution with azide, and hydride reduction provided w-amino functionalized intermediates 12a-d as well. Coupling intermediates 9a-d and 12a-d with the selected fluorophores (9- anthracene carboxylic acid, 4-chloro-7-nitrobenz-2-oxa-l,3-diazole, 5- dimethylaminonapthalene-l-sulfonyl chloride, and I-methyl-2H-3,1-benzoxazine-2,4(1H)dione), followed by deprotection of the phenolic silyl group, gave the desired fluorescent ligands la-d, 2a-d, 3a-d and 4a-d in good yield. Assessment of their binding affinities with recombinant human a-tocopherol transfer protein (ha-TTP) utilizing fluorescent titration binding assays identified competent ligands for further use in protein studies. Compounds Id (C9-AO-a-Toc) and 2d (C9-NBD-a-Toc) both having nonyl alkyl chain extensions between the chromanol and fluorophore were shown to bind specifically to ha-TTP with dissociation constants (KdS) of approximately 280 nM and 55 nM respectively, as compared to 25 nM for the natural ligand 2R,4'R,^'R-a-tocophQxoL.
Resumo:
Since its discovery in 1922, vitamin E has been widely investigated for its role as a powerful, chain-breaking antioxidant that is required for human health. However, some basic issues still remain unclear, such as the mechanism and dynamics of the intracellular trafficking of a-tocopherol. To better understand tocopherol's biological activity at the cellular level, fluorescence spectroscopy and microscopy have been found to be valuable tools. This thesis reports the synthesis of a new fluorescent analogue of a-tocopherol, atocohexaenol, an intrinsically fluorescent analogue of a-tocopherol. Different methodologies of preparation have been attempted and a strategy using a preformed chromanol head plus ClO and Cs portion of the polyene side chain finally provided us the desired a-tocohexaenol. a-Tocohexaenol shows a strong fluorescence in both ethanol and hexanes with maximum Aab = 368 nm and maximum /...em = 521 nm. This compound is stable for a couple of weeks in ethanol or hexane solution if stored at 0 °C and protected form light. It decomposes slowly at room temperature and light will accelerate its decomposition (within 5 hours). Thus, a-Tocohexaenol may be a useful fluorescent probe to study the biochemistry and cell biology of vitamin E.
Resumo:
(A) Most azobenzene-based photoswitches require UV light for photoisomerization, which limit their applications in biological systems due to possible photodamage. Cyclic azobenzene derivatives, on the other hand, can undergo cis-trans isomerization when exposed to visible light. A shortened synthetic scheme was developed for the preparation of a building block containing cyclic azobenzene and D-threoninol (cAB-Thr). trans-Cyclic azobenzene was found to thermally isomerize back to the cis-form in a temperature-dependent manner. cAB-Thr was transformed into the corresponding phosphoramidite and subsequently incorporated into oligonucleotides by solid phase synthesis. Melting temperature measurement suggested that incorporation of cis-cAB into oligonucleotides destabilizes DNA duplexes, these findings corroborate with circular dichroism measurement. Finally, Fluorescent Energy Resonance Transfer experiments indicated that trans-cAB can be accommodated in DNA duplexes. (B) Inverse Electron Demand Diels-Alder reactions (IEDDA) between trans-olefins and tetrazines provide a powerful alternative to existing ligation chemistries due to its fast reaction rate, bioorthogonality and mutual orthogonality with other click reactions. In this project, an attempt was pursued to synthesize trans-cyclooctene building blocks for oligonucleotide labeling by reacting with BODIPY-tetrazine. Rel-(1R-4E-pR)-cyclooct-4-enol and rel-(1R,8S,9S,4E)-Bicyclo[6.1.0]non-4-ene-9-ylmethanol were synthesized and then transformed into the corresponding propargyl ether. Subsequent Sonogashira reactions between these propargylated compounds with DMT-protected 5-iododeoxyuridine failed to give the desired products. Finally a methodology was pursued for the synthesis of BODIPY-tetrazine conjugates that will be used in future IEDDA reactions with trans-cyclooctene modified oligonucleotides.
Resumo:
Tesis (Maestría en Ciencias con Especialidad en Morfología) UANL
Resumo:
Tesis (Maestría en Ciencias con Especialidad en Producción Agrícola) UANL