Finding genes for economically important traits: Brahman cattle puberty.

Age at puberty is an important component of reproductive performance in beef cattle production systems. Brahman cattle are typically late-pubertal relative to Bos taurus cattle and so it is of economic relevance to select for early age at puberty. To assist selection and elucidate the genes underlying puberty, we performed a genome-wide association study (GWAS) using the BovineSNP50 chip (similar to 54 000 polymorphisms) in Brahman bulls (n = 1105) and heifers (n = 843) and where the heifers were previously analysed in a different study. In a new attempt to generate unbiased estimates of single-nucleotide polymorphism (SNP) effects and proportion of variance explained by each SNP, the available data were halved on the basis of year and month of birth into a calibration and validation set. The traits that defined age at puberty were, in heifers, the age at which the first corpus luteum was detected (AGECL, h(2) = 0.56 +/- 0.11) and in bulls, the age at a scrotal circumference of 26 cm (AGE26, h(2) = 0.78 +/- 0.10). At puberty, heifers were on average older (751 +/- 142 days) than bulls (555 +/- 101 days), but AGECL and AGE26 were genetically correlated (r = 0.20 +/- 0.10). There were 134 SNPs associated with AGECL and 146 SNPs associated with AGE26 (P < 0.0001). From these SNPs, 32 (similar to 22%) were associated (P < 0.0001) with both traits. These top 32 SNPs were all located on Chromosome BTA 14, between 21.95 Mb and 28.4 Mb. These results suggest that the genes located in that region of BTA 14 play a role in pubertal development in Brahman cattle. There are many annotated genes underlying this region of BTA 14 and these are the subject of current research. Further, we identified a region on Chromosome X where markers were associated (P < 1.00E-8) with AGE26, but not with AGECL. Information about specific genes and markers add value to our understanding of puberty and potentially contribute to genomic selection. Therefore, identifying these genes contributing to genetic variation in AGECL and AGE26 can assist with the selection for early onset of puberty.

Damage and physiological stress to juvenile eastern rock lobster (Sagmariasus verreauxi) discarded after trapping and hand collection

Large numbers of Sagmariasus verreauxi are trapped and hand collected in Australia, but discarded due to size and quota restrictions, and under the unevaluated assumption of few impacts. To test the validity of enforced discarding, trapped and hand-collected S. verreauxi (49-143. mm carapace length - CL) were examined for external damage, placed into cages, transferred to aquaria and monitored (with controls) over three months. Haemolymph was non-repetitively sampled immediately and at one, three, and seven days to quantify stress. Most trapped (64%) and hand-collected (79%) specimens were undersized (<104. mm CL), with the latter method yielding broader ranges of sizes and moult stages. Within-trap Octopus tetricus predation caused the only mortalities (3.3%). Hand collection resulted in much greater antennae and pereopod loss than trapping (53 vs. 4%) but, compared to controls, both methods evoked benign physiological responses that resolved within a week. While most wounded S. verreauxi regenerated all or some missing appendages post-moult, their mean CLs were less than those from intact conspecifics. Simple strategies, including larger mesh sizes, and/or installing modifications to reduce bycatch in traps, careful hand collection, and appropriate release techniques might minimise impacts (including predation) to unwanted S. verreauxi, and help to control stock exploitation. © 2012 Elsevier B.V.

The study of oxidation state of manganese in lead oxyhalide glasses by optical spectroscopy

Abstaract is not available.

Developmental and growth controls of tillering and water-soluble carbohydrate accumulation in contrasting wheat (Triticum aestivum L.) genotypes: can we dissect them?

In wheat, tillering and water-soluble carbohydrates (WSCs) in the stem are potential traits for adaptation to different environments and are of interest as targets for selective breeding. This study investigated the observation that a high stem WSC concentration (WSCc) is often related to low tillering. The proposition tested was that stem WSC accumulation is plant density dependent and could be an emergent property of tillering, whether driven by genotype or by environment. A small subset of recombinant inbred lines (RILs) contrasting for tillering was grown at different plant densities or on different sowing dates in multiple field experiments. Both tillering and WSCc were highly influenced by the environment, with a smaller, distinct genotypic component; the genotypeenvironment range covered 350750 stems m(2) and 25210mg g(1) WSCc. Stem WSCc was inversely related to stem number m(2), but genotypic rankings for stem WSCc persisted when RILs were compared at similar stem density. Low tilleringhigh WSCc RILs had similar leaf area index, larger individual leaves, and stems with larger internode cross-section and wall area when compared with high tilleringlow WSCc RILs. The maximum number of stems per plant was positively associated with growth and relative growth rate per plant, tillering rate and duration, and also, in some treatments, with leaf appearance rate and final leaf number. A common threshold of the red:far red ratio (0.390.44; standard error of the difference0.055) coincided with the maximum stem number per plant across genotypes and plant densities, and could be effectively used in crop simulation modelling as a ocut-off' rule for tillering. The relationship between tillering, WSCc, and their component traits, as well as the possible implications for crop simulation and breeding, is discussed.

Magnetic interactions in the oxide systems LaNi1-xMxO3 (M = Cr, Fe, or Co)

Magnetic susceptibilities of several members of the series of oxides of the general formula LaNi1-xMxO3 (M = Cr, Fe, or Co) are reported. The oxides show evidence for interesting ferrimagnetic (Cr and Co) and antiferromagnetic (Fe) interactions.

An oxygenase from guinea-pig liver which catalyses sulphoxidation

A mono-oxygenase catalysing the conversion of 2-ethyl-4-thioisonicotinamide (ethionamide) into its sulphoxide was purified from guinea-pig liver homogenates. The enzyme required stoicheiometric amounts of oxygen and NADPH for the sulphoxidation reaction. The purified protein is homogeneous by electrophoretic, antigenic and chromatographic criteria. The enzyme has mol.wt. 85000 and it contains 1g-atom of iron and 1mol of FAD per mol, but not cytochrome P-450. The enzyme shows maximal activity at pH7.4 in a number of different buffer systems and the Km values calculated for the substrate and NADPH are 6.5×10-5m and 2.8×10-5m respectively. The activation energy of the reaction was calculated to be 36kJ/mol. Under optimal conditions, the molecular activity of the enzyme (mol of substrate oxidized/min per mol of enzyme) is calculated to be 2.1. The oxygenase belongs to the class of general drug-metabolizing enzymes and it may act on different compounds which can undergo sulphoxidation. The mechanism of sulphoxidation was shown to be mediated by superoxide anions.

Indigofera spicata (creeping indigo) poisoning of three ponies

Three ponies continuously grazed a pasture containing an estimated 24% Indigofera spicata (wet weight basis) for 4–6 weeks in April and May 2004. They developed ataxia, paresis, depression, muscle fasciculations, dysphagia, ptyalism and halitosis. Two also developed corneal opacity. One pony recovered with supportive treatment, but the other two were euthanased and necropsied. Neuropathology was not present in either case, but both livers had periacinar and periportal lymphocytic infiltrations and hydropic degeneration of mid-zonal hepatocytes, with mild to moderate periacinar necrosis also evident in one. The I. spicata contained 2.66 mg 3-nitropropionic acid (3-NPA)/g dry matter and 1.5 mg indospicine/g dry matter. Indospicine, but not 3-NPA, was detected in serum from both of the euthanased ponies and indospicine was detected in heart, liver and muscle from the one pony in which this assay was performed. The clinical syndrome closely resembled ‘Birdsville horse disease’ caused by I. linnaei and was similar to that reported in horses poisoned by the closely related species I. hendecaphylla and to 3-NPA poisoning of other animals, including humans. 3-NPA is thought to cause this neurological syndrome. To our knowledge, this is the first authenticated report of I. spicata poisoning in grazing animals. We also report here the first published evidence that 3-NPA and indospicine exist in naturalised I. spicata in Australia and of the formation of indospicine residues in tissues of animals grazing paddocks infested with I. spicata.

Electrical and optical properties of amorphous semiconducting GeSe and GeSbSe films

The electrical activation energy and optical band-gap of GeSe and GeSbSe thin films prepared by flash evaporation on to glass substrates have been determined. The conductivities of the films were found to be given by Image , the activation energy Ea being 0.53 eV and 0.40 eV for GeSe and GeSbSe respectively. The optical absorption constant α near the absorption edge could be described by Image from which the optical band-gaps E0 were found to be 1.01 eV for GeSe and 0.67 eV for GeSbSe at 300°K. At 110°K the corresponding values of E0 were 1.07 eV and 0.735 eV respectively. The significance of these values is discussed in relation to those of other amorphous semiconductors.

3,3',5,5'-Tetrabromophenolsulfonphthalein (bromphenol blue), C19H10Br4O5S

M r=670.02, monoclinic, C2/c, a= 31.003(4), b=11.037(2), c=21.183(3)A, fl= 143.7 (1) °, V= 4291.2/k 3, D,n = 2.06, D x = 2.07Mgm -3, Z=8, MoKa, 2=0.7107/k, /~=7.45 mm -1, F(000) = 2560, T= 293 K, R = 0.061 for 1697 observed reflections. The bromphenol blue molecule consists essentially of three planar groupings: the sulfonphthalein ring system and two dibromophenol rings attached to the tetrahedral C atom of the five-membered ring of the sulfonphthalein system. The dibromophenol rings are inclined with resPect to each other at 73 ° whereas they make angles of 85 and 68 ° with respect to the sulfonphthalein system. The molecules aggregate into helical columns with the non-polar regions of the molecules in the interior and the polar regions on the surface. The columns are held together by a network of hydrogen bonds.

Townsend's First Ionization Coefficients and Sparking Potentials in Crossed Electric and Magnetic Fields

Townsend's first ionization coefficients have been measured in corssed electric and magnetic fields for values of B/p ranging from 0.013 TESLA. TORR-1 to 0.064 TESLA.TORR-1 and for 103 x 102¿ E/p 331 x 102 V.M-1. TORR-1 in oxygen and for 122 x 102¿ E/pÂ488 x 102 V.M-1.TORR-1 for dry air. The values of effective collision frequencies determined from the equivalent pressure (pe) concept generally increase with E/p at constant B/p and decrease with increasing B/p at constant E/p. Effective collision frequencies determined from measured sparking potentials at high values of E/p increase with decreasing E/pe. The drift velocity and mean energy of electrons in oxygen in crossed electric and magnetic fields have been derived.

Role of F-gravity in cosmological models

Abstract is not available.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

X-ray studies on crystalline complexes involving amino acids and peptides. XXIII. Variability in ionization state, conformation and molecular aggregation in the complexes of succinic acid with DL- and L-lysine

Crystalline complexes of succinic acid with DL- and L-lysine have been prepared and analysed by X-ray diffraction. DL-Lysine complex: C6HIsN202 + 1 2- 1 ~C4H404 .~C4H604, Mr -- 264"2, PI, a = 5"506 (4), =8.070(2), c=14.089(2) A,, a=92.02(1), /3= 100"69 (3), y = 95"85 (3) ~>, Z = 2, Dx = 1"44 g cm -3, R = 0.059 for 2546 observed reflections. Form I of the e-lysine complex: C6HIsN20-, ~ .C4H504, Mr = 264.2, P1, a = 5" 125 (2), b = 8"087 (1), c = 8"689 (1) A,, a = 112.06 (1), /3 = 99.08 (2), y = 93"77(2) °, Z--l, D,,,=1"34(3), Dx=l"34gcm 3 R = 0.033 for 1475 observed reflections. Form II of + I 2- the e-lysine complex: C6H15N202 .,iC4H404 .- 1 I ") 4C4H604.4(C4HsO4""H'"CaH404)" , Mr = 264"2, P1, a = 10.143 (4), b = 10.256 (2), c = 12"916 (3) A,, a = 105.00 (2),/3 = 99-09 (3), y = 92"78 (3)::, Z = 4, Dm= 1"37(4), D,.= 1.38gcm 3, R=0.067 for 2809 observed reflections. The succinic acid molecules in the structures exhibit a variety of ionization states. Two of the lysine conformations found in the complexes have been observed for the first time in crystals containing lysine. Form II of the L-lysine complex is highly pseudosymmetric. In all the complexes, unlike molecules aggregate into separate alternating layers. The basic element of aggregation in the lysine layer in the complexes is an S2-type head-to-tail sequence. This element combines in different ways in the three structures. The basic element of aggre gation in the succinic acid layer in the complexes is a hydrogen-bonded ribbon. The ribbons are interconnected indirectly through amino groups in the lysine layer.

Besides tracking: Simulation of RFID marketing and beyond

This paper asks a new question: how we can use RFID technology in marketing products in supermarkets and how we can measure its performance or ROI (Return-on-Investment). We try to answer the question by proposing a simulation model whereby customers become aware of other customers' real-time shopping behavior and may hence be influenced by their purchases and the levels of purchases. The proposed model is orthogonal to sales model and can have the similar effects: increase in the overall shopping volume. Managers often struggle with the prediction of ROI on purchasing such a technology, this simulation sets to provide them the answers of questions like the percentage of increase in sales given real-time purchase information to other customers. The simulation is also flexible to incorporate any given model of customers' behavior tailored to particular supermarket, settings, events or promotions. The results, although preliminary, are promising to use RFID technology for marketing products in supermarkets and provide several dimensions to look for influencing customers via feedback, real-time marketing, target advertisement and on-demand promotions. Several other parameters have been discussed including the herd behavior, fake customers, privacy, and optimality of sales-price margin and the ROI of investing in RFID technology for marketing purposes. © 2010 Springer Science+Business Media B.V.