Impact Of Drug Formulation And Free Platinum/cisplatin Ratio On Hypersensitivity Reactions To Cisplatin: Formulation Matters.

Use of cisplatin can induce type I hypersensitivity reactions that may also be linked to the quality of the drug utilized. We observed cases of hypersensitivity that appeared to be associated with the brand of cisplatin used. The aim of this study was to compare two different brands of cisplatin in relation to type I hypersensitivity reactions. Brand A was used in a tertiary care teaching hospital until 2012, and use of brand B started from January 2013, when the first hypersensitivity cases were observed. Patients were categorized based on symptom. Cisplatin of both brands was analysed by high-performance liquid chromatography (HPLC) and high-resolution electrospray ionization mass spectrometry (ESI-(+)-MS) and characterized according to US Pharmacopeia. There were no cases of hypersensitivity associated with the use of cisplatin brand A, whereas four of 127 outpatients that used cisplatin brand B were affected. The two brands were in accordance with the US Pharmacopeia parameters, and there was no significant difference in the total platinum levels between the two brands when analysed by HPLC. However, high-resolution ESI-(+)-MS analyses show that brand B contains approximately 2.7 times more hydrolysed cisplatin than brand A. The increase in the hydrolysed form of cisplatin found in brand B may be the cause of the hypersensitivity reaction observed in a subset of patients. We present the first study of the quality of drugs by high-resolution ESI-(+)-MS. Drug regulatory agencies and manufacturers should consider including measurement of hydrolysed cisplatin as a quality criterion for cisplatin formulations.

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Análise do investimento em climatização para bovinos de leite em sistema de alojamento free-stall

The difficulty in adapting European dairy cows breeds in Brazil affect considerably the milk production sector. Brazilian climatic conditions are not totally favorable and the development of new tecnologies is needed for the animals express their genetic potential, as well as their best feed conversion. An economical analysis of the applied investment in the free-stall climatization equipment in dairy housing, for estimating studies related to profit, possibility of return investment as well as time for this return is necessary. The objective of this research was to evaluate the influence of climatization investment in the milk production process and analyze the economical aspect of this investment. There were used 470 high productive dairy cows with genetic and morphologic homogeneous characteristics, and analyzed in two similar periods. Investment calculations were done using Excell®. The results were satisfactory and the invested capital was proved to return to the producer in a short term, 57 days.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

A abordagem centrada na pessoa e a psicologia do esporte : vivência de um psicólogo com jogadores e a comissão técnica de uma equipe durante os períodos de preparação e disputa da Copa São Paulo de Futebol Júnior

Universidade Estadual de Campinas . Faculdade de Educação Física

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Spatial pattern detection modeling of thrips (Thrips tabaci) on onion fields

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.

Detection of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.

Evaluation of DNA extraction protocols for Brucella abortus pcr detection in aborted fetuses or calves born from cows experimentally infected with strain 2308

The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.

Avaliação de metais traços e íons majoritários em águas de chuva na cidade de São Paulo

Rainfall samples collected in the downtown area of São Paulo city, during 2003, exhibited average concentrations of cadmium, lead and copper of 1.33, 8.52 and 49.5 nmol L-1, respectively. Among the major ions, NH4+ was the predominant species followed by NO3-, SO4(2-) and Ca2+, with volume weighed mean (VWM) concentrations of 37.1, 20.1, 11.9 and 10.8 µmol L-1, respectively. All the determined species showed high inter-events variability, including free H+ ions whose VWM concentration was 4.03 µmol L-1, corresponding to a pH value of 5.39.

A closer look at multiple-clone Plasmodium vivax infections: detection methods, prevalence and consequences

The naturally occurring clonal diversity among field isolates of the major human malaria parasite Plasmodium vivax remained unexplored until the early 1990s, when improved molecular methods allowed the use of blood samples obtained directly from patients, without prior in vitro culture, for genotyping purposes. Here we briefly review the molecular strategies currently used to detect genetically distinct clones in patient-derived P. vivax samples, present evidence that multiple-clone P. vivax infections are commonly detected in areas with different levels of malaria transmission and discuss possible evolutionary and epidemiological consequences of the competition between genetically distinct clones in natural human infections. We suggest that, when two or more genetically distinct clones are present in the same host, intra-host competition for limited resources may select for P. vivax traits that represent major public health challenges, such as increased virulence, increased transmissibility and antimalarial drug resistance.

Pre-processing for noise detection in gene expression classification data

Due to the imprecise nature of biological experiments, biological data is often characterized by the presence of redundant and noisy data. This may be due to errors that occurred during data collection, such as contaminations in laboratorial samples. It is the case of gene expression data, where the equipments and tools currently used frequently produce noisy biological data. Machine Learning algorithms have been successfully used in gene expression data analysis. Although many Machine Learning algorithms can deal with noise, detecting and removing noisy instances from the training data set can help the induction of the target hypothesis. This paper evaluates the use of distance-based pre-processing techniques for noise detection in gene expression data classification problems. This evaluation analyzes the effectiveness of the techniques investigated in removing noisy data, measured by the accuracy obtained by different Machine Learning classifiers over the pre-processed data.

Detecção de estímulos concêntricos mesópicos em crianças surdas e ouvintes

O objetivo deste trabalho foi medir curvas de sensibilidade ao contraste de 10 crianças ouvintes e de 10 crianças com surdez pré-lingual, de 7 a 12 anos, utilizando frequências radiais circularmente concêntricas (FSCr) de 0,25-2,0 cpg em níveis baixos de luminância (0,7 cd/m²). Todos os participantes apresentavam acuidade visual normal e estavam livres de doenças oculares identificáveis. A FSCr foi medida com o método psicofísico da escolha forçada. Os resultados mostraram sensibilidade máxima na faixa de frequência radial de 0,25 cpg para os dois grupos. Os resultados mostraram ainda diferenças significantes entre as curvas de FSCr de crianças ouvintes e de crianças com surdez pré-lingual. Isto é, as crianças ouvintes precisaram de menos contraste do que as crianças surdas para detectar as frequências radiais. Esses resultados sugerem que, em níveis baixos de luminância, a FSCr das crianças ouvintes foi melhor do que a das crianças com surdez pré-lingual.

Development of instrumentation for amperometric and coulometric detection using ultramicroelectrodes

In this work it is presented the development of a simple, portable and inexpensive instrumentation for amperometric and coulometric detection in different analytical instrumentation systems utilizing ultramicroelectrodes. The software, developed in LabVIEW 7.1TM, is capable to carry out three main detection techniques (amperometric, pulsed amperometric and coulometric detection) and a voltammetric technique (cyclic voltammetry). The instrumentation was successfully evaluated using the following systems: cyclic voltammograms of metallic electrodes in alkaline solutions, flow electrochemical detection of glucose and glycine and direct determination of herbicide glyphosate (electrochemical detection coupled to HPLC).