Modelos vrs. Modelos . Acercamiento inicial a la cuestión tecnológica en algunos manuales sobre caficultura, 1774-1895

ResumenEn este trabajo se ofrece una comparación inicial de los modelos tecnológicos explícitos e implícitos propuestos o supuestos por los autores de una serie de tratados generales, manuales y estudios sobre caficultura, tanto europeos o estadounidenses como caribeños y latinoamericanos. También se contrastan las recomendaciones técnicas como las diversas prácticas de cultivo y procesamiento que se traslucen a través de las páginas de dichos textos.AbstractThe study offers an initial comparison of the explicit and implicit technological models suggested or assumed by the author of a series of general treatises, manuals and studies on coffee, both by Europeans or North Americans and by Caribbeans or Latin Americans. Technical recommendations are also contrasted with the various agricultural and processing systems actually in use, as reflected in the pages of those same texts.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Ginastica artistica feminina e historia oral : a formação desportiva de ginastas brasileiras participantes de jogos olimpicos (1980-2004)

Universidade Estadual de Campinas . Faculdade de Educação Física

A historia da ginastica ritmica em Campinas

Universidade Estadual de Campinas . Faculdade de Educação Física

Escola Nacional de Educação Fisica e Desportos : uma possivel historia

Universidade Estadual de Campinas . Faculdade de Educação Física

Description of the pupal case of Systropus (Systropus) nitidus Wiedemann, 1830 (Diptera, Bombyliidae, Toxophorinae, Systropodini)

The pupal case of Systropus (Systropus) nitidus Wiedemann reared from an unidentified tipical Limacodidae (Lepidoptera) cocoon is described and illustrated for the first time. Only species of Limacodidae are recorded as host of the immature stages of S. (Systropus). The geographical distribution of S. (Systropus) nitidus is restricted to Brazil, from Pará to Santa Catarina states. This is the first pupal case description and illustration of a Neotropical species of the subgenus Systropus.

A phylogenetic study of the subtribe Dicrepidiina (Elateridae, Elaterinae, Ampedini)

It is presented a cladistic analysis of the Dicrepidiina aiming to test the monophyletism of the subtribe and to establish the relationships among the genera. The subtribe is composed by 36 genera and all of them, except Asebis, Lamononia, Neopsephus, Semiotopsis and Spilomorphus were included in the analysis. Fifty two species, especially the type-species of each genus were studied: Achrestus flavocinctus (Candèze, 1859), A. venustus Champion, 1895, Adiaphorus gracilis Schwarz, 1901, A. ponticerianus Candèze, 1859, Anoplischiopsis bivittatus Champion, 1895, Anoplischius bicarinatus Candèze, 1859, A. conicus Candèze, 1900, A. haematopus Candèze, 1859, A. pyronotus Candèze, 1859, Atractosomus flavescens (Germar, 1839), Blauta cribraria (Germar, 1844), Calopsephus apicalis (Schwarz, 1903), Catalamprus angustus (Fleutiaux, 1902), Crepidius flabellifer (Erichson, 1847), C. resectus Candèze, 1859, Cyathodera auripilosus Costa, 1968, C. lanugicollis (Candèze, 1859), C. longicornis Blanchard, 1843, Dayakus angularis Candèze, 1893, Dicrepidius ramicornis (Palisot de Beauvois, 1805), Dipropus brasilianus (Germar, 1824), D. factuellus Candèze, 1859, D. laticollis (Eschscholtz, 1829), D. pinguis (Candèze, 1859), D. schwarzi (Becker, 1961), Elius birmanicus Candèze, 1893, E. dilatatus Candèze, 1878, Heterocrepidius gilvellus Candèze, 1859, H. ventralis Guérin-Méneville, 1838, Lampropsephus cyaneus (Candèze, 1878), Loboederus appendiculatus (Perty, 1830), Olophoeus gibbus Candèze, 1859, Ovipalpus pubescens Solier, 1851, Pantolamprus ligneus Candèze, 1896, P. mirabilis Candèze, 1896, P. perpulcher Westwood, 1842, Paraloboderus glaber Golbach, 1990, Proloboderus crassipes Fleutiaux, 1912, Propsephus beniensis (Candèze, 1859), P. cavifrons (Erichson, 1843), Pseudolophoeus guineensis (Candèze, 1881), Rhinopsephus apicalis (Schwarz, 1903), Sephilus formosanus Schwarz, 1912, S. frontalis Candèze, 1878, Singhalenus gibbus Candèze, 1892, S. taprobanicus Candèze, 1859, Sphenomerus antennalis Candèze, 1859, S. brunneus Candèze, 1865, Spilus atractomorphus Candèze, 1859, S. nitidus Candèze, 1859, Stenocrepidius simonii Fleutiaux, 1891 and Trielasmus varians Blanchard, 1846. Chalcolepidius zonatus (Hemirhipini, Agrypninae), Ctenicera silvatica (Prosternini, Prosterninae), and species of the other subtribes of Ampedini (Elaterinae): Ampedus sanguineus (Ampedina), Melanotus spernendus (Melanotina) and Anchastus digittatus and Physorhinus xanthocephalus (Physorhinina) were used as outgroups. The results of the phylogenetic analysis demonstrated that Dicrepidiina, as formerly defined, does not form a monophyletic group. One genus, represented by Ovipalpus pubescens, was removed from the subtribe. The subtribe is characterized by presence of lamella under 2nd and 3rd tarsomeres of all legs. Also, it was revealed that the genera Achrestus, Anoplischius, Dipropus and Propsephus are not monophyletic. Due to the scarcity of information, all the studied species are redescribed and illustrated.

Cytogenetic analysis of Astylus antis (Perty, 1830) (Coleoptera, Melyridae): Karyotype, heterochromatin and location of ribosomal genes

Cytogenetic analysis of Astylus antis using mitotic and meiotic cells was performed to characterize the haploid and diploid numbers, sex determination system, chromosome morphology, constitutive heterochromatin distribution pattern and chromosomes carrying nucleolus organizer regions (NORs). Analysis of spermatogonial metaphase cells revealed the diploid number 2n = 18, with mostly metacentric chromosomes. Metaphase I cells exhibited 2n = 8II+Xyp and a parachute configuration of the sex chromosomes. Spermatogonial metaphase cells submitted to C-banding showed the presence of small dots of constitutive heterochromatin in the centromeric regions of nearly all the autosomes and on the short arm of the X chromosome (Xp), as well as an additional band on one of the arms of pair 1. Mitotic cells submitted to double staining with base-specific fluorochromes (DAPI-CMA3) revealed no regions rich in A+T or G+C sequences. Analysis of spermatogonial mitotic cells after sequential Giemsa/AgNO3 staining did not reveal any specific mark on the chromosomes. Meiotic metaphase I cells stained with silver nitrate revealed a strong impregnation associated to the sex chromosomes, and in situ hybridization with an 18S rDNA probe showed ribosomal cistrons in an autosomal bivalent.

A New Species of Riama from Ecuador Previously Referred to as Riama hyposticta (Boulenger, 1902) (Squamata: Gymnophthalmidae)

We describe Riama crypta, new species, from the western slopes of the Cordillera Occidental, Ecuador. This taxon was formerly referred to as Riama hyposticta, a rare species described on the basis of an adult male from northern Ecuador and here recorded from southwestern Colombia. The new species differs principally from Riama hyposticta by an incomplete superciliary series, formed just by the anteriormost superciliary scale (superciliary series complete in R. hyposticta, formed by five or six scales), no nasoloreal suture [= loreal absent] (complete (= loreal present] in R. hyposticta), distinct dorsolateral stripes at least anteriorly (scattered brown spots dorsally without dorsolateral stripes in R. hyposticta), and ventral coloration composed of small cream or brown spots or longitudinal stripes (dark brown with conspicuous transverse white bars and spots). Additionally, we document the presence of distal filiform appendages on the hemipenial lobes of both species.

Pycnoscelus surinamensis (Linnaeus, 1758) (Blaberoidea: Blaberidae), a cockroach with a possible association with the ant Brachymyrmex cordemoyi Forel, 1895 (Hymenoptera: Formicidae) and which may be exhibiting a domiciliation trend.

In the present paper, we report on the occurrence of the cockroach Pycnoscelus surinamensis (Linnaeus, 1758) in Brachymyrmex cordemoyi Forel, 1895 nests, indicating a possible symbiosis between these two species. Also, the finding of intradomicile P. surinamensis nymphs may indicate this species is extending its habitat to human habitations, i.e. changing its ecological category from peridomestic to domestic.

Historia Nova do Brasil: revisiting a polemical work

This article discusses the texts and purposes of the Historia Nova do Brasil series, a joint production of the Ministerio da Educacao e Cultura and the Instituto Superior de Estudos Brasileiros (Iseb) launched in 1964 and soon aborted by the military dictatorship. The intent is to reconstitute its context to present the many influences on this project and to examine its impact and the debates and disputes that resulted, to try to recover the details of this important effort at renewing the teaching of history in Brazil.