Effect Of Concurrent Training With Blood Flow Restriction In The Elderly.

The aim of this present study was to investigate on the effects of concurrent training with blood flow restriction (BFR-CT) and concurrent training (CT) on the aerobic fitness, muscle mass and muscle strength in a cohort of older individuals. 25 healthy older adults (64.7±4.1 years; 69.33±10.8 kg; 1.6±0.1 m) were randomly assigned to experimental groups: CT (n=8, endurance training (ET), 2 days/week for 30-40 min, 50-80% VO2peak and RT, 2 days/week, leg press with 4 sets of 10 reps at 70-80% of 1-RM with 60 s rest), BFR-CT (n=10, ET, similar to CT, but resistance training with blood flow restriction: 2 days/week, leg press with 1 set of 30 and 3 sets of 15 reps at 20-30% 1-RM with 60 s rest) or control group (n=7). Quadriceps cross-sectional area (CSAq), 1-RM and VO2peak were assessed pre- and post-examination (12 wk). The CT and BFR-CT showed similar increases in CSAq post-test (7.3%, P<0.001; 7.6%, P<0.0001, respectively), 1-RM (38.1%, P<0.001; 35.4%, P=0.001, respectively) and VO2peak (9.5%, P=0.04; 10.3%, P=0.02, respectively). The BFR-CT promotes similar neuromuscular and cardiorespiratory adaptations as CT.

Hemodynamic Changes With Two Lipid Emulsions For Treatment Of Bupivacaine Toxicity In Swines.

To compare the hemodynamic changes following two different lipid emulsion therapies after bupivacaine intoxication in swines. Large White pigs were anesthetized with thiopental, tracheal intubation performed and mechanical ventilation instituted. Hemodynamic variables were recorded with invasive pressure monitoring and pulmonary artery catheterization (Swan-Ganz catheter). After a 30-minute resting period, 5 mg.kg-1 of bupivacaine by intravenous injection was administered and new hemodynamic measures were performed 1 minute later; the animals were than randomly divided into three groups and received 4 ml.kg-1 of one of the two different lipid emulsion with standard long-chaim triglyceride, or mixture of long and medium-chain triglyceride, or saline solution. Hemodynamic changes were then re-evaluated at 5, 10, 15, 20 and 30 minutes. Bupivacaine intoxication caused fall in arterial blood pressure, cardiac index, ventricular systolic work index mainly and no important changes in vascular resistances. Both emulsion improved arterial blood pressure mainly increasing vascular resistance since the cardiac index had no significant improvement. On the systemic circulation the hemodynamic results were similar with both lipid emulsions. Both lipid emulsions were efficient and similar options to reverse hypotension in cases of bupivacaine toxicity.

Reduction Of Blood Nitric Oxide Levels Is Associated With Clinical Improvement Of The Chronic Pelvic Pain Related To Endometriosis.

The objective of this prospective study was to determine the plasma levels of nitric oxide (NO) in women with chronic pelvic pain secondary to endometriosis (n=24) and abdominal myofascial pain syndrome (n=16). NO levels were measured in plasma collected before and 1 month after treatment. Pretreatment NO levels (μM) were lower in healthy volunteers (47.0±12.7) than in women with myofascial pain (64.2±5.0, P=0.01) or endometriosis (99.5±12.9, P<0.0001). After treatment, plasma NO levels were reduced only in the endometriosis group (99.5±12.9 vs 61.6±5.9, P=0.002). A correlation between reduction of pain intensity and reduction of NO level was observed in the endometriosis group [correlation = 0.67 (95%CI = 0.35 to 0.85), P<0.0001]. Reduction of NO levels was associated with an increase of pain threshold in this group [correlation = -0.53 (-0.78 to -0.14), P<0.0001]. NO levels appeared elevated in women with chronic pelvic pain diagnosed as secondary to endometriosis, and were directly associated with reduction in pain intensity and increase in pain threshold after treatment. Further studies are needed to investigate the role of NO in the pathophysiology of pain in women with endometriosis and its eventual association with central sensitization.

Nitric Oxide Released From Luminal S-nitroso-n-acetylcysteine Increases Gastric Mucosal Blood Flow.

Nitric oxide (NO)-mediated vasodilation plays a key role in gastric mucosal defense, and NO-donor drugs may protect against diseases associated with gastric mucosal blood flow (GMBF) deficiencies. In this study, we used the ex vivo gastric chamber method and Laser Doppler Flowmetry to characterize the effects of luminal aqueous NO-donor drug S-nitroso-N-acetylcysteine (SNAC) solution administration compared to aqueous NaNO2 and NaNO3 solutions (pH 7.4) on GMBF in Sprague-Dawley rats. SNAC solutions (600 μM and 12 mM) led to a rapid threefold increase in GMBF, which was maintained during the incubation of the solutions with the gastric mucosa, while NaNO2 or NaNO3 solutions (12 mM) did not affect GMBF. SNAC solutions (600 μM and 12 mM) spontaneously released NO at 37 °C at a constant rate of 0.3 or 14 nmol·mL-1·min-1, respectively, while NaNO2 (12 mM) released NO at a rate of 0.06 nmol·mL-1·min-1 and NaNO3 (12 mM) did not release NO. These results suggest that the SNAC-induced GMBF increase is due to their higher rates of spontaneous NO release compared to equimolar NaNO2 solutions. Taken together, our data indicate that oral SNAC administration is a potential approach for gastric acid-peptic disorder prevention and treatment.

(-)-tarchonanthuslactone Exerts A Blood Glucose-increasing Effect In Experimental Type 2 Diabetes Mellitus.

A number of studies have proposed an anti-diabetic effect for tarchonanthuslactone based on its structural similarity with caffeic acid, a compound known for its blood glucose-reducing properties. However, the actual effect of tarchonanthuslactone on blood glucose level has never been tested. Here, we report that, in opposition to the common sense, tarchonanthuslactone has a glucose-increasing effect in a mouse model of obesity and type 2 diabetes mellitus. The effect is acute and non-cumulative and is present only in diabetic mice. In lean, glucose-tolerant mice, despite a slight increase in blood glucose levels, the effect was not significant.

Bartonella Clarridgeiae Bacteremia Detected In An Asymptomatic Blood Donor.

Human exposure to Bartonella clarridgeiae has been reported only on the basis of antibody detection. We report for the first time an asymptomatic human blood donor infected with B. clarridgeiae, as documented by enrichment blood culture, PCR, and DNA sequencing.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparação entre diferentes ciclo simuladores e ciclismo em velódromo : testes de desempenho máximo de 5 quilômetros

Universidade Estadual de Campinas . Faculdade de Educação Física

Impacto das atividades fisicas nos indicadores de saude de sujeitos adultos : programa mexa-se

Universidade Estadual de Campinas . Faculdade de Educação Física

Suplementação com caldo de cana de açucar comparado com outros carboidratos na reposição do glicogenio e cinetica de biomarcadores pos-exercicio agudo em ratos

Universidade Estadual de Campinas . Faculdade de Educação Física

Efeito de onze semanas de treinamento sobre a velocidade critica e o limiar anaerobio em nadadores

Universidade Estadual de Campinas . Faculdade de Educação Física

Monitoramento de parâmetros imunológicos em atletas adolescentes de basquetebol durante e após a temporada esportiva= : Monitoring of immunological parameters in adolescent basketball athletes during and after a sports season

Universidade Estadual de Campinas . Faculdade de Educação Física

Respostas agudas da variabilidade da frequência cardíaca após sesão de exercício de força com restrição de fluxo sanguíneo = : Acute responses of heart rate variabiblity afer blood flow restriction resistance exercise

Universidade Estadual de Campinas . Faculdade de Educação Física

Variabilidade da frequencia cardiaca em trabalhadores em turnos

Universidade Estadual de Campinas . Faculdade de Educação Física

Contribution Of Antepartum And Intrapartum Hemorrhage To The Burden Of Maternal Near Miss And Death In A National Surveillance Study

Objective To evaluate the occurrence of severe obstetric complications associated with antepartum and intrapartum hemorrhage among women from the Brazilian Network for Surveillance of Severe Maternal Morbidity.Design Multicenter cross-sectional study.Setting Twenty-seven obstetric referral units in Brazil between July 2009 and June 2010.Population A total of 9555 women categorized as having obstetric complications.Methods The occurrence of potentially life-threatening conditions, maternal near miss and maternal deaths associated with antepartum and intrapartum hemorrhage was evaluated. Sociodemographic and obstetric characteristics and the use of criteria for management of severe bleeding were also assessed in these women.Main outcome measures The prevalence ratios with their respective 95% confidence intervals adjusted for the cluster effect of the design, and multiple logistic regression analysis were performed to identify factors independently associated with the occurrence of severe maternal outcome.Results Antepartum and intrapartum hemorrhage occurred in only 8% (767) of women experiencing any type of obstetric complication. However, it was responsible for 18.2% (140) of maternal near miss and 10% (14) of maternal death cases. On multivariate analysis, maternal age and previous cesarean section were shown to be independently associated with an increased risk of severe maternal outcome (near miss or death).Conclusion Severe maternal outcome due to antepartum and intrapartum hemorrhage was highly prevalent among Brazilian women. Certain risk factors, maternal age and previous cesarean delivery in particular, were associated with the occurrence of bleeding.