Metodologia de Verificação Funcional para Circuitos Analógicos

This work proposes a new methodology to verify those analog circuits, providing an automated tools to help the verifiers to have a more truthful result. This work presents the development of new methodology for analog circuits verification. The main goal is to provide a more automated verification process to certify analog circuits functional behavior. The proposed methodology is based on the golden model technique. A verification environment based on this methodology was built and results of a study case based on the validation of an operational amplifier design are offered as a confirmation of its effectiveness. The results had shown that the verification process was more truthful because of the automation provided by the tool developed

Uma metodologia para redução de incertezas em sistema de medição de vazão de óleo e gás

The objective of this research is to discuss about the need for implementation of new alternatives for the implementation on the metrological control: on the findings of initial and subsequent measurements, the control procedures of measurement uncertainty applied in assessing the loss or remains found in handling operations of bulk liquids, when used turbine meters used in measuring the tax on the business of Petrobras, due to the current environment of legal metrology and scientific, both domestic and international. We aim, with these alternatives: standardizing the minimization of random and systematic errors, the estimate of the remaining errors, as well as the management control of metrological calibration procedures, control of measurement uncertainty, and contribute to the change in the form of performance of legal metrology and scientific disseminating new information to change management of metrological control, objectively focused on aspects of supervision in implementing these activities in the control of the uncertainties of measurement used in our processes in the fiscal measurement system Petrobras. Results are presented, information and comments on the influence of measurement uncertainty in the current results of the fiscal and transfer of custody. This will emphasize the need, among other things, improvement and expansion of metrological control monitored by setting a better meet demand, calibration equipment and measuring instruments for Petrobras. Finally, we intend to establish the need for improving the method of evaluation of the data meter applied to the current management control of measurement uncertainty by proposing a methodology for addressing the problem, as well as highlighting the expected results.

Metodologia para avaliação do desempenho de receptor de GPS de uso agrícola em condição cinemática

Activities that use Global Navigation Satellite System (GNSS) are countless and the most used one is the Global Positioning System (GPS) developed by the United States. In precision agriculture there are demands for static and cinematic positioning with distinct levels of accuracy for different applications; nevertheless cinematic performance data are not available as manufacturers of GPS receivers present only static performance information. For this reason it was developed an instrumented vehicle to test a methodology of performance evaluation of GPS receivers in kinematic conditions, which is representative to agricultural operations. A set of instrumentation was composed and used for collecting data under variable speed and rotation direction. Tests were conducted showing that the methodology allows to measure accuracy and precision, but improvements have to be implemented on the instrumentation equipment for long term tests.

Metodologia para re-sintonia de controladores PID industriais

The present work has as objective to present a method of project and implementation of controllers PID, based on industrial instrumentation. An automatic system of auto-tunning of controllers PID will be presented, for systems of first and second order. The software presented in this work is applied in controlled plants by PID controllers implemented in a CLP. Software is applied to make the auto-tunning of the parameters of controller PID of plants that need this tunning. Software presents two stages, the first one is the stage of identification of the system using the least square recursive algorithm and the second is the stage of project of the parameters of controller PID using the root locus algorithm. An important fact of this work is the use of industrial instrumentation for the accomplishment of the experiments. The experiments had been carried through in controlled real plants for controllers PID implemented in the CLP. Thus has not only one resulted obtained with theoreticians experiments made with computational programs, and yes resulted obtained of real systems. The experiments had shown good results gotten with developed software

ISE-SPL: Uma abordagem baseada em linha de produtos de software aplicada à geração automática de sistemas para educação médica na plataforma E-learning

E-learning, which refers to the use of Internet-related technologies to improve knowledge and learning, has emerged as a complementary form of education, bringing advantages such as increased accessibility to information, personalized learning, democratization of education and ease of update, distribution and standardization of the content. In this sense, this paper aims to develop a tool, named ISE-SPL, whose purpose is the automatic generation of E-learning systems for medical education, making use of concepts of Software Product Lines. It consists of an innovative methodology for medical education that aims to assist professors of healthcare in their teaching through the use of educational technologies, all based on computing applied to healthcare (Informatics in Health). The tests performed to validate the ISE-SPL were divided into two stages: the first was made by using a software analysis tool similar to ISE-SPL, called SPLOT and the second was performed through usability questionnaires to healthcare professors who used ISESPL. Both tests showed positive results, proving it to be an efficient tool for generation of E-learning software and useful for professors in healthcare

Uma proposta de metodologia para o ensino de Física usando robótica de baixíssimo custo

This paper presents methodology based on Lev Vigotsky`s social interactionist theory through investigative activities, which integrates the teaching of physics to robotics, directed to students of the Physics degree course, seeking to provide further training for future teachers. The method is organized through educational robotics workshops that addresses concepts of physics through the use of low-cost educational robots along with several activities. The methodology has been presented and discussed and put into practice afterwards in workshops so that these future teachers may be able to take robotics to their classroom. Students from the last and penultimate semester of the Physics degree course of the Federal Institute of Education, Science and Technology of Rio Grande do Norte, Caicó campus participated in this project

Painéis-sanduíche com núcleo de EPS reciclado: metodologia de execução e determinação de propriedades termofísicas

New materials made from industrial wastes have been studied as an alternative to traditional fabrication processes in building and civil engineering. These materials are produced considering some issues like: cost, efficiency and reduction of nvironmental damage. Specifically in cases of materials destined to dwellings in low latitude regions, like Brazilian Northeast, efficiency is related to mechanical and thermal resistance. Thus, when thermal insulation and energetic efficiency are aimed, it s important to increase thermal resistance without depletion of mechanical properties. This research was conducted on a construction element made of two plates of cement mortar, interspersed with a plate of recycled expanded polystyrene (EPS). This component, widely known as sandwich-panel, is commonly manufactured with commercial EPS whose substitution was proposed in this study. For this purpose it was applied a detailed methodology that defines parameters to a rational batching of the elements that constitute the nucleus. Samples of recycled EPS were made in two different values of apparent specific mass (ρ = 65 kg/m³; ρ = 130 kg/m³) and submitted to the Quick-Line 30TM that is a thermophysical properties analyzer. Based on the results of thermal conductivity, thermal capacity and thermal diffusivity obtained, it was possible to assure that recycled EPS has thermal insulation characteristics that qualify it to replace commercial EPS in building and civil engineering industry

Metodologia de análise e diagnóstico de fratura em um componente automotivo sujeito a cargas cíclicas alternadas

The competitiveness of the trade generated by the higher availability of products with lower quality and cost promoted a new reality of industrial production with small clearances. Track deviations at the production are not discarded, uncertainties can statistically occur. The world consumer and the Brazilian one are supported by the consumer protection code, in lawsuits against the products poor quality. An automobile is composed of various systems and thousands of constituent parts, increasing the likelihood of failure. The dynamic and security systems are critical in relation to the consequences of possible failures. The investigation of the failure gives us the possibility of learning and contributing to various improvements. Our main purpose in this work is to develop a systematic, specific methodology by investigating the root cause of the flaw occurred on an axle end of the front suspension of an automobile, and to perform comparative data analyses between the fractured part and the project information. Our research was based on a flaw generated in an automotive suspension system involved in a mechanical judicial cause, resulting in property and personal damages. In the investigations concerning the analysis of mechanical flaws, knowledge on materials engineering plays a crucial role in the process, since it enables applying techniques for characterizing materials, relating the technical attributes required from a respective part with its structure of manufacturing material, thus providing a greater scientific contribution to the work. The specific methodology developed follows its own flowchart. In the early phase, the data in the records and information on the involved ones were collected. The following laboratory analyses were performed: macrography of the fracture, micrography with SEM (Scanning Electron Microscope) of the initial and final fracture, phase analysis with optical microscopy, Brinell hardness and Vickers microhardness analyses, quantitative and qualitative chemical analysis, by using X-ray fluorescence and optical spectroscopy for carbon analysis, qualitative study on the state of tension was done. Field data were also collected. In the analyses data of the values resulting from the fractured stock parts and the design values were compared. After the investigation, one concluded that: the developed methodology systematized the investigation and enabled crossing data, thus minimizing diagnostic error probability, the morphology of the fracture indicates failure by the fatigue mechanism in a geometrically propitious location, a tension hub, the part was subjected to low tensions by the sectional area of the final fracture, the manufacturing material of the fractured part has low ductility, the component fractured in an earlier moment than the one recommended by the manufacturer, the percentages of C, Si, Mn and Cr of the fractured part present values which differ from the design ones, the hardness value of the superior limit of the fractured part is higher than that of the design, and there is no manufacturing uniformity between stock and fractured part. The work will contribute to optimizing the guidance of the actions in a mechanical engineering judicial expertise

Metodologia, Sistema de Codificação e Ferramenta de software para Modelagem de Móveis Modulados

On this research we investigated how new technologies can help the process of design and manufacturing of furniture in such small manufacturers in Rio Grande do Norte state. Google SketchUp, a 3D software tool, was developed in such a way that its internal structures are opened and can be accessed using SketchUp s API for Ruby and programs written in Ruby language (plugins). Using the concepts of the so-called Group Technology and the flexibility that enables adding new functionalities to this software, it was created a Methodology for Modeling of Furniture, a Coding System and a plugin for Google s tool in order to implement the Methodology developed. As resulted, the following facilities are available: the user may create and reuse the library s models over-and-over; reports of the materials manufacturing process costs are provided and, finally, detailed drawings, getting a better integration between the furniture design and manufacturing process

Validação de uma metodologia de ensaio de resistência ao cisalhamento para avaliação da aderência de interfaces revestimento metálico-bainha de cimento aplicada a poços de petróleo

Improving the adherence between oilwell metallic casing and cement sheath potentially decrease the number of corrective actions present/y necessary for Northeastern wells submitted to steam injection. In addition to the direct costs involved in the corrective operations, the economic impact of the failure of the primary cementing aIso includes the loss in the production of the well. The adherence between casing and cement is current/y evaluated by a simple shear tests non standardized by the American Petroleum Institute (API). Therefore, the objective of the present is to propose and evaluate a standardized method to assess the adherence of oilwell metallic casing to cement sheath. To that end, a section of a cemented oilwell was simulated and used to test the effect of different parameters on the shear stress of the system. Surface roughness and different cement compositions submitted or not to thermal cycling were evaluated. The results revealed that the test geometry and parameters proposed yielded different values for the shear stress of the system, corresponding to different adherent conditions between metallic casing and cement sheath

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Comparação da precisão dos resultados do teste de tetrazolio usando a metodologia alternativa e a tradicional em sementes de soja

The use of tetrazolium testing is recognized in the soybean seed quality control due to the large amount of data which it provides. Although it is considered a quick test, in 1998 an alternative methodology was proposed for the seed preconditioning, which allows 10 hours of time saving in seeds preparation. The objective of this research is to compare the accuracy of the new and the traditional tetrazolium testing. Three soybean seed genotypes were used, Conquista, Garantia and M-soy 8400, all 2000/2001 crop. The seeds were evaluated in relation to germination, evaluated with the traditional (TZt) and the alternative (Tza) tetrazolium test as well as with the accelerated aging performed in two different conditions (45 degrees C 24h(-1) and 45 degrees C 72h(-1)). After aging, the seeds too were submitted to TZt and Tza testing. The experimental design was a randomized blocks, with four replicates the 50 seeds per genotype in every evaluation, with exception only for tetrazolium test, with two replicates. The averages were compared in the Tukey test level of 5% probability. The comparison between the two methodologies in relation to level of vigor (class 1 to 3) and germination potential (class 1 to 5) indicated no statistical discrepancies, for aged non-aged seeds. This, the use of the alternative tetrazolium test is recommend in case a reduced seed preparation time is needed.

Aplicação e análise de metodologia de deterioração ambiental em micro-bacia do seridó potiguar

In the contemporary world to the deterioration of semi-arid areas of the planet has been the focus of media attention and the scientific community. Brazil has a semiarid, considered the most problematic of the world, either by pressure from physical factors, whether as a result of misguided public policies, has over time been suffering from the consequences of a deterioration that expands over the years. Methodologies, that amidst the problems of semi-arid, come against the deteriorating local, have a good chance to be reapplied in other contexts around the world. This research, based on methodological model for analyzing environmental deterioration, introduced and examined the applicability of the methodology in the semi-arid region of Rio Grande do Norte - Brazil. Although the results provide guidelines for the introduction of underground dams, the application of the methodology was ineffective, given the high rates of forest cover that gave low values for the physical diagnosis conservationist

Análise de necessidades de inglês para fins específicos em um curso de graduação em turismo

This study presents the results of a survey conducted in the area of English for Specific Purposes (ESP) in order to identify (1) the learning needs of students in a course in Tourism, their desires and lacks, at a federal university, with respect to use of English; (2) the needs of the present situation of teachers and the coordinator of that course as to the language; (3) the needs of the target situation of professionals (graduates) and companies with respect to this language. This research is a case study (STAKE, 1998; YIN, 2009) and was used for data collection, instruments such as questionnaires, semi-structured interviews, and document on the Tourism Course. To this end, it was adopted the theoretical basis for the constructs of English for Specific Purposes (ESP) Inglês para Fins Específicos (IFE) in Brazil, also known as Inglês Instrumental, whose foundation is based on the work by Hutchinson and Waters (1987), Robinson (1991), Dudley-Evans and St. John (1998), Celani, Deyes, Holmes, Scott (2006), among others, since this work is devoted to a specific area, Tourism. Results show that students opined the ability to prioritize reading and speaking into the classroom. Professionals reported that the latter is an indispensable tool for entering the labor market, yet they feel unprepared and need to attend English language courses in private language schools. The testimony of company executives also point to this deficiency. Finally, the present situation of teachers reveals that, while advocating the use of English in the classroom, this is not because students prefer their mother tongue. There is also an evident lack of needs analysis. Eventually, the coordinator said that there is some uncertainty as to the methodology, content and language skills worked, and the lack of interaction among teachers of English. It was concluded, therefore, it is important to conduct a needs analysis so that one can redesign a course that meets the different contextual needs: students, teachers, coordination, represented by the institutional needs, and the labor market

O hipertexto eletrônico de meio ambiente : estratégias de leitura e navegação

The incorporation of computing in class instigate the use of the Internet and websites as a content support in the teaching/leaning process. This kind of practice had challenged the students to read through eletronic hypertextual means. In that way, we re trying to undestand which strategies of reading and navigation the students of the second and third grade of highschool levels are using when reading electronic hypertexts from the www.ambientebrasil.com.br website. The research took place in the Escola Estadual Jerônimo Rosado in Mossoró RN. Our theoretical base was estructured on the digital Technology (electronic hypertext estructure and it s navigation modes), in applied linguistics (act of reading) and in cognition (interaction of the reader with the text and the use of reading strategies in the virtual computing enviroment). The applied methodology was the case analysis which was developed with the reunion of collected data through qualitative reseach questionaries, direct observations and video recording sessions. The research demonstrates that reader s ability in the act of navigating on virtual sites activates his/her reading strategies. Also shows how the semantic architecture of the hyperlinks can interfere directly over the strategies of reading and navigation in specific websites. Our research also intend to demonstrate that the student use his strategies of linear text reading when are not accustomed to use the reading through websites in a regular basis. The investigation concludes observing that the amount of hypertexts per pages and the inappropriate use of the multimedia elements were harmful to the reading fluency