960 resultados para Pcr Instability


Relevância:

20.00% 20.00%

Publicador:

Resumo:

To investigate microbial diversity and identify spoilage bacteria in fresh pork sausages during storage, twelve industrial pork sausages of different trademarks were stored at 4 ºC for 0, 14, 28 and 42 days, 80% relative humidity and packaged in sterile plastic bags. Microbiological analysis was performed. The pH and water activity (a w) were measured. The culture-independent method performed was the Polymerase Chain Reaction - Denaturing Gradient Gel Electrophoresis (PCR-DGGE). The culture-dependent method showed that the populations of mesophilic bacteria and Lactic Acid Bacteria (LAB) increased linearly over storage time. At the end of the storage time, the average population of microorganisms was detected, in general, at the level of 5 log cfu g-1. A significant (P < 0.005) increase was observed in pH and a w values at the end of the storage time. The PCR-DGGE allowed a rapid identification of dominant communities present in sausages. PCR-DGGE discriminated 15 species and seven genera of bacteria that frequently constitute the microbiota in sausage products. The most frequent spoilage bacteria identified in the sausages were Lactobacillus sakei and Brochothrix thermosphacta. The identification of dominant communities present in fresh pork sausages can help in the choice of the most effective preservation method for extending the product shelf-life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The physiochemical and biological properties of honey are directly associated to its floral origin. Some current commonly used methods for identification of botanical origin of honey involve palynological analysis, chromatographic methods, or direct observation of the bee behavior. However, these methods can be less sensitive and time consuming. DNA-based methods have become popular due to their simplicity, quickness, and reliability. The main objective of this research is to introduce a protocol for the extraction of DNA from honey and demonstrate that the molecular analysis of the extracted DNA can be used for its botanical identification. The original CTAB-based protocol for the extraction of DNA from plants was modified and used in the DNA extraction from honey. DNA extraction was carried out from different honey samples with similar results in each replication. The extracted DNA was amplified by PCR using plant specific primers, confirming that the DNA extracted using the modified protocol is of plant origin and has good quality for analysis of PCR products and that it can be used for botanical identification of honey.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Maize seeds, infected by Stenocarpella species, are important sources of inoculum for the introduction and dissemination of stalk and ear rot and macrospore leaf spot diseases. The use of healthy seeds is an important strategy for the preventive control of these diseases. However, one of the difficulties in the health quality control programs for maize seeds is the availability of a reliable and quick method for detecting these fungi during routine seed analyses. Therefore, the objective of the present study was to investigate the possibility of using the PCR technique as an alternative method for accurately detecting these pathogens in maize seed samples. Maize seeds were kept in contact with S. maydis colonie developed in PDA media containing mannitol at -1.4 MPa for 72 h. The seed samples used in this study were prepared with infected seeds at incidences of 100, 20, 10, 2, 1 and zero %.The primers used were able to detect S. maydis fungi in association with seeds with a maximum of 2% , however those primers were not able to differentiate between the two species.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Kvantitatiivinen reaaliaikainen polymeraasiketjureaktio (engl. polymerase chain reaction, PCR) on osoittautunut käyttäjäystävällisimmäksi menetelmäksi nukleiinihapposekvenssien kvantitoimisessa. Tätä menetelmää voidaan herkistää pienempien DNA-pitoisuuksien havaitsemiseen käyttämällä hyväksi aikaerotteista fluorometriaa (engl. time-resolved fluorometry, TRF) ja luminoivia lantanidileimoja, joiden fluoresenssin pitkän eliniän ansiosta emission mittaus voidaan suorittaa vasta hetki virittävän valopulssin jälkeen, jolloin lyhytikäinen taustasäteily ehtii sammua. Tuloksena saadaan korkea signaali-taustasuhde. Tämän diplomityön tarkoituksena oli rakentaa TRF:än pystyvä reaaliaikainen PCR-laite, sillä tällaista laitetta ei ole markkinoilla tarjolla. Laite rakennettiin kehittämällä lämpökierrätin ja yhdistämällä se valmiiseen TRF:än kykenevään mittapäähän. Mittapään ja lämpökierrättimen hallitsemiseksi kehitettiin myös tietokoneohjelma. Valon tuottamiseksi ja mittaamiseksi haluttiin käyttää edullisia komponentteja, joten työssä käytettiin valmiin mittapään optiikkaa, jossa viritys tapahtuu hohtodiodilla (engl. light-emitting diode, LED) ja lantanidileiman emission mittaus fotodiodilla (engl. photodiode, PD) tai valomonistinputkella (engl. photomultiplier tube, PMT). Myös mittapään suorituskykyä tutkittiin. Työtä varten kehitettiin lämpökierrätin, joka koostui Peltier-elementillä lämmitettävästä PCR-putkitelineestä ja lämpökannesta. Mittalaitteen suorituskyvyn tutkimiseen käytettiin kelaattikomplementaatioon perustuvaa PCR-tuotteen havaitsemismenetelmää. Kelaattikomplementaatio perustuu kahteen erilliseen oligonukleotidimolekyyliin, joista toiseen on sidottu lantanidi-ioni ja toiseen valoa absorboiva ligandirakenne, jotka yhdessä muodostavat fluoresoivan kokonaisuuden. Kehitetyn lämpökierrättimen todettiin olevan tarpeeksi tarkka sekä tehokas ja sen lämmitys- ja jäähdytysnopeuden maksimeiksi saatiin 2,6 °C/sekunti. Detektorina käytetyn PD:n ei todettu olevan tarpeeksi herkkä emission havainnoimiseksi ja se korvattiin laitteessa PMT:llä. Käytetyllä PCR-määrityksellä kynnyssykleiksi (engl. threshold cycle, Ct) sekä kehitetylle että referenssilaitteelle saatiin 28,4 käyttämällä samaa 100 000 kopion DNA:n aloitusmäärää. Työssä osoitettiin, että on mahdollista kehittää edullisia komponentteja käyttävä, TRF:än pystyvä, reaaliaikainen PCR-laite, joka kykenee vastaavaan Ct-arvoon kuin vertailulaite. PD:n herkkyys ei kuitenkaan riittänyt. Tulokset olivat lupaavia, sillä LED- ja PD-teknologiat kehittyvät ja markkinoille on tullut myös muita komponentteja, joiden avulla on tulevaisuudessa mahdollista kehittää vielä herkempi laite.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper analyses reasons of the instability of the world monetary system. The author considers this problem from historical and contemporary perspectives. According to presented point of view banknotes and electronic money which replaced gold and silver coins in popular circulation are the most important reason of the instability. There are also proven positive and negative consequences of money instability. Reforms of the world monetary system need agreement within the global collective hegemony of state-powers and transnational corporations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Adenoviral vectors are currently the most widely used gene therapeutic vectors, but their inability to integrate into host chromosomal DNA shortened their transgene expression and limited their use in clinical trials. In this project, we initially planned to develop a technique to test the effect of the early region 1 (E1) on adenovirus integration by comparing the integration efficiencies between an E1-deleted adenoviral vector (SubE1) and an Elcontaining vector (SubE3). However, we did not harvest any SubE3 virus, even if we repeated the transfection and successfully rescued the SubE1 virus (2/4 transfections generated viruses) and positive control virus (6/6). The failure of rescuing SubE3 could be caused by the instability of the genomic plasmid pFG173, as it had frequent intemal deletions when we were purifying It. Therefore, we developed techniques to test the effect of E1 on homologous recombination (HR) since literature suggested that adenovirus integration is initiated by HR. We attempted to silence the E1 in 293 cells by transfecting E1A/B-specific small interfering RNA (siRNA). However, no silenced phenotype was observed, even if we varied the concentrations of E1A/B siRNA (from 30 nM to 270 nM) and checked the silencing effects at different time points (48, 72, 96 h). One possible explanation would be that the E1A/B siRNA sequences are not potent enough to Induce the silenced phenotype. For evaluating HR efficiencies, an HR assay system based on bacterial transfonmatJon was designed. We constmcted two plasmids ( designated as pUC19-dl1 and pUC19-dl2) containing different defective lacZa cassettes (forming white colonies after transformation) that can generate a functional lacZa cassette (forming blue colonies) through HR after transfecting into 293 cells. The HR efficiencies would be expressed as the percentages of the blue colonies among all the colonies. Unfortunately, after transfonnation of plasmid isolated from 293 cells, no colony was found, even at a transformation efficiency of 1.8x10^ colonies/pg pUC19, suggesting the sensitivity of this system was low. To enhance the sensitivity, PCR was used. We designed a set of primers that can only amplify the recombinant plasmid fomied through HR. Therefore, the HR efficiencies among different treatments can be evaluated by the amplification results, and this system could be used to test the effect of E1 region on adenovirus integration. In addition, to our knowledge there was no previous studies using PCR/ Realtime PCR to evaluate HR efficiency, so this system also provides a PCR-based method to carry out the HR assays.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Exposure to chronic stress can alter the structure and function of brain regions involved in learning and memory, and these effects are typically long-lasting if the stress occurs during sensitive periods of development. Until recently, adolescence has received relatively little attention as a sensitive period of development, despite marked changes in behaviour, heightened reactivity to stressors, and cognitive and neural maturation. Therefore, the purpose of the present study was to investigate the long-term effects of chronic stress in adolescence on two spatial learning and memory tasks (Morris water maze and Spatial Object Location test) and on a working memory task (Delayed Alternation task). Male rats were randomly assigned to chronic social instability stress (SS; daily 1 hour isolation and subsequent change of cage partner between postnatal days 30 and 45) or to a no-stress control group (CTL). During acquisition learning in the Morris water maze task, SS rats demonstrated impaired long-term memory for the location of the hidden escape platform compared to CTL rats, although the impairment was only seen after the first day of training. Similarly, SS rats had impaired long-term memory in the Spatial Object Location test after a long delay (240 minutes), but not after shorter delays (15 or 60 minutes) compared to CTL rats. On the Delayed Alternation task, which assessed working memory across delays ranging from 5 to 90 seconds, no group differences were observed. These results are partially in line with previous research that revealed adult impairment on spatial learning and memory tasks after exposure to chronic social instability stress in adolescence. The observed deficits, however, appear to be limited to long-term memory as no group differences were observed during brief periods of retention.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Human endogenous retroviruses (HERVs) are the result of ancient germ cell infections of human germ cells by exogenous retroviruses. HERVs belong to the long terminal repeat (LTR) group of retrotransposons that comprise ~8% of the human genome. The majority of the HERVs documented have been truncated and/or incurred lethal mutations and no longer encode functional genes; however a very small number of HERVs seem to maintain functional in making new copies by retrotranspositon as suggested by the identification of a handful of polymorphic HERV insertions in human populations. The objectives of this study were to identify novel insertion of HERVs via analysis of personal genomic data and survey the polymorphism levels of new and known HERV insertions in the human genome. Specifically, this study involves the experimental validation of polymorphic HERV insertion candidates predicted by personal genome-based computation prediction and survey the polymorphism level within the human population based on a set of 30 diverse human DNA samples. Based on computational analysis of a limited number of personal genome sequences, PCR genotyping aided in the identification of 15 dimorphic, 2 trimorphic and 5 fixed full-length HERV-K insertions not previously investigated. These results suggest that the proliferation rate of HERVKs, perhaps also other ERVs, in the human genome may be much higher than we previously appreciated and the recently inserted HERVs exhibit a high level of instability. Throughout this study we have observed the frequent presence of additional forms of genotypes for these HERV insertions, and we propose for the first time the establishment of new genotype reporting nomenclature to reflect all possible combinations of the pre-integration site, solo-LTR and full-length HERV alleles.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Tesis (Maestría en Ciencias con Especialidad en Morfología) UANL

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Tesis (Maestría en Ciencias con Especialidad en Entomología Médica) UANL