Oropouche Virus Infection And Pathogenesis Is Restricted By Mavs, Irf-3, Irf-7, And Type I Ifn Signaling Pathways In Non-myeloid Cells.

Oropouche virus (OROV) is a member of the Orthobunyavirus genus in the Bunyaviridae family and a prominent cause of insect-transmitted viral disease in Central and South America. Despite its clinical relevance, little is known about OROV pathogenesis. To define the host defense pathways that control OROV infection and disease, we evaluated OROV pathogenesis and immune responses in primary cells and mice that were deficient in the RIG-I-like receptor signaling pathway (MDA5, RIG-I, or MAVS), downstream regulatory transcription factors (IRF-3 or IRF-7), IFN-β, or the receptor for type I IFN signaling (IFNAR). OROV replicated to higher levels in primary fibroblasts and dendritic cells lacking MAVS signaling, the transcription factors IRF-3 and IRF-7, or IFNAR. In mice, deletion of IFNAR, MAVS, or IRF-3 and IRF-7 resulted in uncontrolled OROV replication, hypercytokinemia, extensive liver damage, and death whereas wild-type (WT) congenic animals failed to develop disease. Unexpectedly, mice with a selective deletion of IFNAR on myeloid cells (CD11c Cre(+) Ifnar(f/f) or LysM Cre(+) Ifnar(f/f)) did not sustain enhanced disease with OROV or La Crosse virus, a closely related encephalitic orthobunyavirus. In bone marrow chimera studies, recipient irradiated Ifnar(-/-) mice reconstituted with WT hematopoietic cells sustained high levels of OROV replication and liver damage, whereas WT mice reconstituted with Ifnar(-/-) bone marrow were resistant to disease. Collectively, these results establish a dominant protective role for MAVS, IRF-3 and IRF-7, and IFNAR in restricting OROV virus infection and tissue injury, and suggest that IFN signaling in non-myeloid cells contributes to the host defense against orthobunyaviruses. Oropouche virus (OROV) is an emerging arthropod-transmitted orthobunyavirus that causes episodic outbreaks of a debilitating febrile illness in humans in countries of South and Central America. The continued expansion of the range and number of its arthropod vectors increases the likelihood that OROV will spread into new regions. At present, the pathogenesis of OROV in humans or other vertebrate animals remains poorly understood. To define cellular mechanisms of control of OROV infection, we performed infection studies in a series of primary cells and mice that were deficient in key innate immune genes involved in pathogen recognition and control. Our results establish that a MAVS-dependent type I IFN signaling pathway has a dominant role in restricting OROV infection and pathogenesis in vivo.

Comparative Study Of Transgenic And Non-transgenic Maize (zea Mays) Flours Commercialized In Brazil, Focussing On Proteomic Analyses.

Genetically modified foods are a major concern around the world due to the lack of information concerning their safety and health effects. This work evaluates differences, at the proteomic level, between two types of crop samples: transgenic (MON810 event with the Cry1Ab gene, which confers resistance to insects) and non-transgenic maize flour commercialized in Brazil. The 2-D DIGE technique revealed 99 differentially expressed spots, which were collected in 2-D PAGE gels and identified via mass spectrometry (nESI-QTOF MS/MS). The abundance of protein differences between the transgenic and non-transgenic samples could arise from genetic modification or as a result of an environmental influence pertaining to the commercial sample. The major functional category of proteins identified was related to disease/defense and, although differences were observed between samples, no toxins or allergenic proteins were found.

High Prevalence Of Insulin Resistance Assessed By The Glucose Clamp Technique In Hormonal And Non-hormonal Contraceptive Users.

Objective To assess the prevalence of insulin resistance (IR) and associated factors in contraceptive users. Methods A total of 47 women 18 to 40 years of age with a body mass index (kg/m(2)) < 30, fasting glucose levels < 100 mg/dl and 2-hour glucose level < 140 mg/dl after a 75-g oral glucose load were submitted to a hyperinsulinemic-euglycemic clamp. The women were distributed in tertiles regarding M-values. The analysed variables were use of combined hormonal/non-hormonal contraception, duration of use, body composition, lipid profile, glucose levels and blood pressure. Results IR was detected in 19% of the participants. The women with low M-values presented significantly higher body fat mass, waist-to-hip ratio, fasting insulin, HOMA-IR and were nulligravida, showed > 1 year of contraceptive use and higher triglyceride levels. IR was more frequent among combined oral contraceptive users, however no association was observed after regression analysis. Conclusions The prevalence of IR was high among healthy women attending a family planning clinic independent of the contraceptive method used with possible long-term negative consequences regarding their metabolic and cardiovascular health. Although an association between hormonal contraception and IR could not be found this needs further research. Family planning professionals should be proactive counselling healthy women about the importance of healthy habits.

Chronic Continuous Exenatide Infusion Does Not Cause Pancreatic Inflammation And Ductal Hyperplasia In Non-human Primates.

In this study, we aimed to evaluate the effects of exenatide (EXE) treatment on exocrine pancreas of nonhuman primates. To this end, 52 baboons (Papio hamadryas) underwent partial pancreatectomy, followed by continuous infusion of EXE or saline (SAL) for 14 weeks. Histological analysis, immunohistochemistry, Computer Assisted Stereology Toolbox morphometry, and immunofluorescence staining were performed at baseline and after treatment. The EXE treatment did not induce pancreatitis, parenchymal or periductal inflammatory cell accumulation, ductal hyperplasia, or dysplastic lesions/pancreatic intraepithelial neoplasia. At study end, Ki-67-positive (proliferating) acinar cell number did not change, compared with baseline, in either group. Ki-67-positive ductal cells increased after EXE treatment (P = 0.04). However, the change in Ki-67-positive ductal cell number did not differ significantly between the EXE and SAL groups (P = 0.13). M-30-positive (apoptotic) acinar and ductal cell number did not change after SAL or EXE treatment. No changes in ductal density and volume were observed after EXE or SAL. Interestingly, by triple-immunofluorescence staining, we detected c-kit (a marker of cell transdifferentiation) positive ductal cells co-expressing insulin in ducts only in the EXE group at study end, suggesting that EXE may promote the differentiation of ductal cells toward a β-cell phenotype. In conclusion, 14 weeks of EXE treatment did not exert any negative effect on exocrine pancreas, by inducing either pancreatic inflammation or hyperplasia/dysplasia in nonhuman primates.

Aplicação do escore MELD em pacientes submetidos a transplante de fígado: análise retrospectiva da sobrevida e dos fatores preditivos a curto e longo prazo

BACKGROUND: The model for end-stage liver disease (MELD) was developed to predict short-term mortality in patients with cirrhosis. There are few reports studying the correlation between MELD and long-term posttransplantation survival. AIM: To assess the value of pretransplant MELD in the prediction of posttransplant survival. METHODS: The adult patients (age >18 years) who underwent liver transplantation were examined in a retrospective longitudinal cohort of patients, through the prospective data base. We excluded acute liver failure, retransplantation and reduced or split-livers. The liver donors were evaluated according to: age, sex, weight, creatinine, bilirubin, sodium, aspartate aminotransferase, personal antecedents, brain death cause, steatosis, expanded criteria donor number and index donor risk. The recipients' data were: sex, age, weight, chronic hepatic disease, Child-Turcotte-Pugh points, pretransplant and initial MELD score, pretransplant creatinine clearance, sodium, cold and warm ischemia times, hospital length of stay, blood requirements, and alanine aminotransferase (ALT >1,000 UI/L = liver dysfunction). The Kaplan-Meier method with the log-rank test was used for the univariable analyses of posttransplant patient survival. For the multivariable analyses the Cox proportional hazard regression method with the stepwise procedure was used with stratifying sodium and MELD as variables. ROC curve was used to define area under the curve for MELD and Child-Turcotte-Pugh. RESULTS: A total of 232 patients with 10 years follow up were available. The MELD cutoff was 20 and Child-Turcotte-Pugh cutoff was 11.5. For MELD score > 20, the risk factors for death were: red cell requirements, liver dysfunction and donor's sodium. For the patients with hyponatremia the risk factors were: negative delta-MELD score, red cell requirements, liver dysfunction and donor's sodium. The regression univariated analyses came up with the following risk factors for death: score MELD > 25, blood requirements, recipient creatinine clearance pretransplant and age donor >50. After stepwise analyses, only red cell requirement was predictive. Patients with MELD score < 25 had a 68.86%, 50,44% and 41,50% chance for 1, 5 and 10-year survival and > 25 were 39.13%, 29.81% and 22.36% respectively. Patients without hyponatremia were 65.16%, 50.28% and 41,98% and with hyponatremia 44.44%, 34.28% and 28.57% respectively. Patients with IDR > 1.7 showed 53.7%, 27.71% and 13.85% and index donor risk <1.7 was 63.62%, 51.4% and 44.08%, respectively. Age donor > 50 years showed 38.4%, 26.21% and 13.1% and age donor <50 years showed 65.58%, 26.21% and 13.1%. Association with delta-MELD score did not show any significant difference. Expanded criteria donors were associated with primary non-function and severe liver dysfunction. Predictive factors for death were blood requirements, hyponatremia, liver dysfunction and donor's sodium. CONCLUSION: In conclusion MELD over 25, recipient's hyponatremia, blood requirements, donor's sodium were associated with poor survival.

Insect mortality in Spathodea campanulata Beauv. (Bignoniaceae) flowers

537

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Utilização de recursos ópticos e equipamentos por escolares com deficiência visual

PURPOSE: To verify perceptions and conduct of students with visual impairment regarding devices and equipment utilized in schooling process. METHODS: A transversal descriptive study on a population of 12-year-old or older students in schooling process, affected by congenital or acquired visual impairment, inserted in the government teaching system of Campinas during the year 2000. An interview quiz, created based on an exploratory study was applied. RESULTS: A group of 26 students, 46% of them with low vision and 53.8% affected by blindness was obtained. Most of the students were from fundamental teaching courses (65.4%), studying in schools with classrooms provided with devices (73.1%). Among the resources used in reading and writing activities, 94.1% of the students reported they used the Braille system and 81.8% reported that the reading subject was dictated by a colleague. Most of the students with low vision wore glasses (91.7%), and 33.3% utilized a magnifying glass as optical devices. Among the non-optical devices, the most common were the environmental ones, getting closer to the blackboard (75.0%) and to the window (66.7%) for better lighting. CONCLUSIONS: It became evident that students with low vision eye-sight made use of devices meant for bearers of blindness, such as applying the Braille system. A reduced number of low vision students making use of optical and non-optical devices applicable to their problems were observed, indicating a probable unawareness of their visual potential and the appropriate devices to improve efficiency.

Pedagogia do esporte : organização, sistematização, aplicação e avaliação de conteúdos esportivos na educação não formal = Sport pedagogy : organization, systematization and application of sports content in non-formal education

Universidade Estadual de Campinas . Faculdade de Educação Física

O setor privado sem fins lucrativos e as políticas públicas de esporte e lazer (2008-2011) = : The non-profitable private sector and the public policies for sport and leisure (2008-2011)

Universidade Estadual de Campinas . Faculdade de Educação Física

Tradução, adaptação cultural e validação da escala Moorong Self-Efficacy Scale (MSES) para o português no Brasil = : Translation, cultural adaptation and validation of Moorong Self-Efficacy Scale (MSES) into Brazilian Portuguese

Universidade Estadual de Campinas . Faculdade de Educação Física

Breastfeeding and non-nutritive sucking patterns related to the prevalence of anterior open bite in primary dentition

OBJECTIVE: Nutritional, immunological and psychological benefts of exclusive breastfeeding for the frst 6 months of life are unequivocally recognized. However, mothers should also be aware of the importance of breastfeeding for promoting adequate oral development. This study evaluated the association between breastfeeding and non-nutritive sucking patterns and the prevalence of anterior open bite in primary dentition. MATERIAL AND METHODS: Infant feeding and non-nutritive sucking were investigated in a 3-6 year-old sample of 1,377 children, from São Paulo city, Brazil. Children were grouped according to breastfeeding duration: G1 - non-breastfed, G2 - shorter than 6 months, G3 - interruption between 6 and 12 months, and G4 - longer than 12 months. Three calibrated dentists performed clinical examinations and classifed overbite into 3 categories: normal, anterior open bite and deep bite. Chi-square tests (p<0.05) with odds ratio (OR) calculation were used for intergroup comparisons. The impact of breastfeeding and non-nutritive sucking on the prevalence of anterior open bite was analyzed using binary logistic regression. RESULTS: The prevalence estimates of anterior open bite were: 31.9% (G1), 26.1% (G2), 22.1% (G3), and 6.2% (G4). G1 would have signifcantly more chances of having anterior open bite compared with G4; in the total sample (OR=7.1) and in the subgroup without history of non-nutritive sucking (OR=9.3). Prolonging breastfeeding for 12 months was associated with a 3.7 times lower chance of having anterior open bite. In each year of persistence with non-nutritive sucking habits, the chance of developing this malocclusion increased in 2.38 times. CONCLUSIONS: Breastfeeding and non-nutritive sucking durations demonstrated opposite effects on the prediction of anterior open bite. Non-breastfed children presented signifcantly greater chances of having anterior open bite compared with those who were breastfed for periods longer than 12 months, demonstrating the benefcial infuence of breastfeeding on dental occlusion.

Dental caries and related factors in Brazilian children from fluoridated and non-fluoridated areas

PURPOSE: To compare the caries prevalence, saliva buffering capacity (SBC), oral hygiene (OH), dietary habits, family income (FI) and frequency of visits to a dental office (Do) between Brazilian children living in areas with and without fluoridated public water supply. METHODS: Forty-six 5-7-year-old preschoolers were selected in Itatiba, SP, Brazil; 19 were from a fluoridated area, and 27 were from a non-fluoridated area. The caries index was determined according to the World Health Organization criteria, and the SBC was assessed by titration with hydrochloric acid. The FI, frequency of OH and visits to Do were estimated by questionnaire. The dietary habits were assessed with a diet chart. The differences between the groups were analyzed with Mann-Whitney-U tests (α=0.05). RESULTS: Children from the non-fluoridated area showed significantly higher dmft/DMFT than those from the fluoridated area, but they showed significantly lower SBC, OH frequency and FI. No significant differences were observed between the areas for dietary habits and visits to Do. CONCLUSION: Children from fluoridated areas showed higher salivary buffering capacity, family income and oral hygiene frequency as well as lower caries prevalence, supporting the beneficial effect of fluoride in the tap water for caries prevention.

Relationship between periodontitis and rheumatoid arthritis and the effect of non-surgical periodontal treatment

This study analyzed the association of periodontal disease (PD) and rheumatoid arthritis (RA). Seventy-five 35-60-year-old patients were assigned to 5 groups according to the presence (+) or not (-) of PD and RA and the treatment received (TR+) or not (TR-) for PD. Group 3 uses total prosthesis (TP). Clinical and laboratory evaluations were performed at baseline, 3 and 6 months of follow-up by probing pocket depth, bleeding on probing and plaque index for PD, HAQ, DAS28, SF-36 and laboratory: AAG, ESR, CRP for RA. Statistically significant differences for PD after 3 (p=0.0055) and after 6 months (p=0.0066) were obtained in Group 1 (RA+PD+TR+) and 2(RA+PD+TR-); significant reduction in the % of BOP after 6 months (p=0.0128) and significant reduction in the % of Pl after 3 (p=0.0128) and 6 months (p=0.0002) in Group 1. Statistically significant differences between Groups 1 and 3 (RA+TP) for DAS28 at baseline and after 3 months were observed, but not after 6 months. No other parameters for RA were significantly affected. The relationship between RA and PD disease activities is not clear, but the importance of periodontal treatment in the control of inflammation to avoid tooth extraction is evident.

Synthesis and biocompatibility of an experimental glass ionomer cement prepared by a non-hydrolytic sol-gel method

The aims of this study were to demonstrate the synthesis of an experimental glass ionomer cement (GIC) by the non-hydrolytic sol-gel method and to evaluate its biocompatibility in comparison to a conventional glass ionomer cement (Vidrion R). Four polyethylene tubes containing the tested cements were implanted in the dorsal region of 15 rats, as follows: GI - experimental GIC and GII - conventional GIC. The external tube walls was considered the control group (CG). The rats were sacrificed 7, 21 and 42 days after implant placement for histopathological analysis. A four-point (I-IV) scoring system was used to graduate the inflammatory reaction. Regarding the experimental GIC sintherization, thermogravimetric and x-ray diffraction analysis demonstrated vitreous material formation at 110oC by the sol-gel method. For biocompatibility test, results showed a moderate chronic inflammatory reaction for GI (III), severe for GII (IV) and mild for CG (II) at 7 days. After 21 days, GI presented a mild reaction (II); GII, moderate (III) and CG, mild (II). At 42 days, GI showed a mild/absent inflammatory reaction (II to I), similar to GII (II to I). CG presented absence of chronic inflammatory reaction (I). It was concluded that the experimental GIC presented mild/absent tissue reaction after 42 days, being biocompatible when tested in the connective tissue of rats.