985 resultados para N-terminal sequence


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Oxysterol binding protein (OSBP) homologues have been found in eukaryotic organisms ranging from yeast to humans. These evolutionary conserved proteins have in common the presence of an OSBP-related domain (ORD) which contains the fully conserved EQVSHHPP sequence motif. The ORD forms a barrel structure that binds sterols in its interior. Other domains and sequence elements found in OSBP-homologues include pleckstrin homology domains, ankyrin repeats and two phenylalanines in an acidic tract (FFAT) motifs, which target the proteins to distinct subcellular compartments. OSBP homologues have been implicated in a wide range of intracellular processes, including vesicle trafficking, lipid metabolism and cell signaling, but little is known about the functional mechanisms of these proteins. The human family of OSBP homologues consists of twelve OSBP-related proteins (ORP). This thesis work is focused on one of the family members, ORP1, of which two variants were found to be expressed tissue-specifically in humans. The shorter variant, ORP1S contains an ORD only. The N-terminally extended variant, ORP1L, comprises a pleckstrin homology domain and three ankyrin repeats in addition to the ORD. The two ORP1 variants differ in intracellular localization. ORP1S is cytosolic, while the ankyrin repeat region of ORP1L targets the protein to late endosomes/lysosomes. This part of ORP1L also has profound effects on late endosomal morphology, inducing perinuclear clustering of late endosomes. A central aim of this study was to identify molecular interactions of ORP1L on late endosomes. The morphological changes of late endosomes induced by overexpressed ORP1L implies involvement of small Rab GTPases, regulators of organelle motility, tethering, docking and/or fusion, in generation of the phenotype. A direct interaction was demonstrated between ORP1L and active Rab7. ORP1L prolongs the active state of Rab7 by stabilizing its GTP-bound form. The clustering of late endosomes/lysosomes was also shown to be linked to the minus end-directed microtubule-based dynein-dynactin motor complex through the ankyrin repeat region of ORP1L. ORP1L, Rab7 and the Rab7-interacting lysosomal protein (RILP) were found to be part of the same effector complex recruiting the dynein-dynactin complex to late endosomes, thereby promoting minus end-directed movement. The proteins were found to be physically close to each other on late endosomes and RILP was found to stabilize the ORP1L-Rab7 interaction. It is possible that ORP1L and RILP bind to each other through their C-terminal and N-terminal regions, respectively, when they are bridged by Rab7. With the results of this study we have been able to place a member of the uncharacterized OSBP-family, ORP1L, in the endocytic pathway, where it regulates motility and possibly fusion of late endosomes through interaction with the small GTPase Rab7.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Antibodies were raised in rabbits against the bovine serum albumin conjugate of dpApT. Analysis by double diffusion in agar gel and quantitative precipitation test showed the presence of antibodies specific to the hapten in the antisera. Quantitative data on the specificity of the antibodies were obtained by studying the inhibition of the binding of 3H-dpApT to the anti-sera by various nonradioactive mono- and oligonucleotides, using a nitrocellulose membrane binding assay. The antibodies were found to be highly specific for the dinucleotide sequence dpApT. The antibodies were able to bind to synthetic oligonucleotides containing the sequence dpApT and to denatured calf thymus DNA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Trimeric autotransporters are a family of secreted outer membrane proteins in Gram-negative bacteria. These obligate homotrimeric proteins share a conserved C-terminal region, termed the translocation unit. This domain consists of an integral membrane β-barrel anchor and associated α-helices which pass through the pore of the barrel. The α-helices link to the extracellular portion of the protein, the passenger domain. Autotransportation refers to the way in which the passenger domain is secreted into the extracellular space. It appears that the translocation unit mediates the transport of the passenger domain across the outer membrane, and no external factors, such as ATP, ion gradients nor other proteins, are required. The passenger domain of autotransporters contains the specific activities of each protein. These are usually related to virulence. In trimeric autotransporters, the main function of the proteins is to act as adhesins. One such protein is the Yersinia adhesin YadA, found in enteropathogenic species of Yersinia. The main activity of YadA from Y. enterocolitica is to bind collagen, and it also mediates adhesion to other molecules of the extracellular matrix. In addition, YadA is involved in serum resistance, phagocytosis resistance, binding to epithelial cells and autoagglutination. YadA is an essential virulence factor of Y. enterocolitica, and removal of this protein from the bacteria leads to avirulence. In this study, I investigated the YadA-collagen interaction by studying the binding of YadA to collagen-mimicking peptides by several biochemical and biophysical methods. YadA bound as tightly to the triple-helical model peptide (Pro-Hyp-Gly)10 as to native collagen type I. However, YadA failed to bind a similar peptide that does not form a collagenous triple helix. As (Pro-Hyp-Gly)10 does not contain a specific sequence, we concluded that a triple-helical conformation is necessary for YadA binding, but no specific sequence is required. To further investigate binding determinants for YadA in collagens, I examined the binding of YadA to a library of collagen-mimicking peptides that span the entire triple-helical sequences of human collagens type II and type III. YadA bound promiscuously to many but not all peptides, indicating that a triple-helical conformation alone is not sufficient for binding. The high-binding peptides did not share a clear binding motif, but these peptides were rich in hydroxyproline residues and contained a low number of charged residues. YadA thus binds collagens without sequence specificity. This strategy of promiscuous binding may be advantageous for pathogenic bacteria. The Eib proteins from Escherichia coli are immunoglobulin (Ig)-binding homologues of YadA. I showed conclusively that recombinant EibA, EibC, EibD and EibF bind to IgG Fc. I crystallised a fragment of the passenger domain of EibD, which binds IgA in addition to IgG. The structure has a YadA-like head domain and an extended coiled-coil stalk. The top half of the coiled-coil is right-handed with hendecad periodicity, whereas the lower half is a canonical left-handed coiled-coil. At the transition from right- to left-handedness, a small β-sheet protrudes from each monomer. I was able to map the binding regions for IgG and IgA using truncations and site-directed mutagenesis to the coiled-coil stalk and identified residues critical for Ig binding.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Reaction of the bromoketals 3, 7a-g and 11 with tri-n-butyltin chloride and sodium cyanoborohydride in the presence of a catalytic amount of AIBN furnished the ethers 5, 8a-g and 13 via a tandem sequence comprising of a radical cyclisation reaction and tri-n-butylhalostannane and sodium cyanoborohydride mediated reductive demethoxylation of the resulting cyclic ketals.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Jacalin [Artocarpus integrifolia (jack fruit) agglutinin] is made up of two types of chains, heavy and light, with M(r) values of 16,200 +/- 1200 and 2090 +/- 300 respectively (on the basis of gel-permeation chromatography under denaturing conditions). Its complete amino acid sequence was determined by manual degradation using a 4-dimethylaminoazobenzene 4'-isothiocyanate double-coupling method. Peptide fragments for sequence analysis were obtained by chemical cleavages of the heavy chain with CNBr, hydroxylamine hydrochloride and iodosobenzoic acid and enzymic cleavage with Staphylococcus aureus proteinase. The peptides were purified by a combination gel-permeation and reverse-phase chromatography. The light chains, being only 20 residues long, could be sequenced without fragmentation. Amino acid analyses and carboxypeptidase-Y-digestion C-terminal analyses of the subunits provided supportive evidence for their sequence. Computer-assisted alignment of the jacalin heavy-chain sequence failed to show sequence similarity to that of any lectin for which the complete sequence is known. Analyses of the sequence showed the presence of an internal repeat spanning residues 7-64 and 76-130. The internal repeat was found to be statistically significant.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

CXCL-8 (Interleukin 8) is a CXC chemokine with a central role in the human immune response. We have undertaken extensive in silico analyses to elucidate the interactions of CXCL-8 with its various binding partners, which are crucial for its biological function. Sequence and structure analyses showed that residues in the thirdq β-sheet and basic residues in the heparin binding site are highly variable, while residues in the second β-sheet are highly conserved. Molecular dynamics simulations in aqueous solution of dimeric CXCL-8 have been performed with starting geometries from both X-ray and NMR structures showed shearing movements between the two antiparallel C-terminal helices. Dynamic conservation analyses of these simulations agreed with experimental data indicating that structural differences between the two structures at quaternary level arise from changes in the secondary structure of the N-terminal loop, the 310-helix, the 30s, 40s, and 50s loops and the third β-sheet, resulting in a different interhelical separation. Nevertheless, the observation of these different states indicates that CXCL-8 has the potential to undergo conformational changes, and it seems likely that this feature is relevant to the mode of binding of glycosaminoglycan (GAG) mimetics such as cyclitols. Simulations of the receptor peptide fragment−CXCL-8 complex identified several specific interactions of the receptor peptide with CXCL-8 that could be exploited in the structure-based design of competitive peptides and nonpeptidic molecules targeting CXCL-8 for combating inflammatory diseases. Simulations of the CXCL-8 dimer complexed with a 24-mer heparin fragment and of the CXCL-8−receptor peptide complex revealed that Arg60, Lys64, and Arg68 in the dimer bind to cyclitols in a horseshoe pattern, defining a region which is spatially distinct from the receptor binding site. There appears to be an optimum number of sulfates and an optimum length of alkyl spacers required for the interaction of cyclitol inhibitors with the dimeric form of CXCL-8. Calculation of the binding affinities of cyclitol inhibitors reflected satisfactorily the ranking of experimentally determined inhibitory potencies. The findings of these molecular modeling studies will help in the search for inhibitors which can modulate various CXCL-8 biological activities and serve as an excellent model system to study CXC-inhibitor interactions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The incidence of human infections by the fungal pathogen Candida species has been increasing in recent years. Enolase is an essential protein in fungal metabolism. Sequence data is available for human and a number of medically important fungal species. An understanding of the structural and functional features of fungal enolases may provide the structural basis for their use as a target for the development of new anti-fungal drugs. We have obtained the sequence of the enolase of Candida krusei (C. krusei), as it is a significant medically important fungal pathogen. We have then used multiple sequence alignments with various enolase isoforms in order to identify C. krusei specific amino acid residues. The phylogenetic tree of enolases shows that the C. krusei enolase assembles on the tree with the fungal genes. Importantly, C. krusei lacks four amino acids in the active site compared to human enolase, as revealed by multiple sequence alignments. These differences in the substrate binding site may be exploited for the design of new anti-fungal drugs to selectively block this enzyme. The lack of the important amino acids in the active site also indicates that C. krusei enolase might have evolved as a member of a mechanistically diverse enolase superfamily catalying somewhat different reactions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

One of the monoclonal antibodies raised against bovine beta-lactoglobulin reacted with human serum retinol binding protein. The finding that this monoclonal antibody also reacted with the serum retinol binding proteins isolated from other animals, suggested that this epitopic conformation is conserved among these proteins. Using ELISA and various synthetic peptides of defined sequence, we show in this paper that the epitope defined by this monoclonal antibody comprises of the highly conserved core sequence of DTDY present in beta-lactoglobulin and retinol binding proteins.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

VP6, the intermediate capsid protein of the virion, specifies subgroup specificity of rotavirus, It is also the most conserved, both at nucleotide and amino acid levels, among group A rotaviruses and is the target of choice for rotavirus detection, In this study we report the sequence of the subgroup I (SGI)-specific VP6 from the serotype G2 strain IS2 isolated from a child suffering from acute diarrhoea in Bangalore ana its comparison with the published VP6 sequences. Interestingly, IS2 gene 6 shared highest homology with that from bovine UK strain and the protein contained substitutions by lysine at amino acid positions 97 and 134, In contrast, the amino acids Met and Glu/Asp at these respective positions are highly conserved in all the other group A rotaviruses sequenced so far, These observations have obvious implications for the evolution of serotype G2 and G2-like strains circulating in India, The SGI VP6, of a human rotavirus, possessing epitopes that are conformationally similar to those found in the native protein in the virion, was successfully expressed in E. coli and purified for the first time by single-step affinity chromatography.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Sesbania mosaic virus (SMV) is an isometric, ss-RNA plant virus found infecting Sesbania grandiflora plants in fields near Tirupathi, South India. The virus particles, which sediment at 116 S at pH 5.5, swell upon treatment with EDTA at pH 7.5 resulting in the reduction of the sedimentation coefficient to 108 S. SMV coat protein amino acid sequence was determined and found to have approximately 60% amino acid sequence identity with that of southern bean mosaic virus (SBMV). The amino terminal 60 residue segment, which contains a number of positively charged residues, is less well conserved between SMV and SBMV when compared to the rest of the sequence. The 3D structure of SMV was determined at 3.0 Å resolution by molecular replacement techniques using SBMV structure as the initial phasing model. The icosahedral asymmetric unit was found to contain four calcium ions occurring in inter subunit interfaces and three protein subunits, designated A, B and C. The conformation of the C subunit appears to be different from those of A and B in several segments of the polypeptide. These observations coupled with structural studies on SMV partially depleted of calcium suggest a plausible mechanisms for the initiation of the disassembly of the virus capsid.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Proteolysis is important in bacterial pathogenesis and colonization of animal and plant hosts. In this work I have investigated the functions of the bacterial outer membrane proteases, omptins, of Yersinia pestis and Salmonella enterica. Y. pestis is a zoonotic pathogen that causes plague and has evolved from gastroenteritis-causing Yersinia pseudotuberculosis about 13 000 years ago. S. enterica causes gastroenteritis and typhoid fever in humans. Omptins are transmembrane β-barrels with ten antiparallel β-strands and five surface-exposed loops. The loops are important in substrate recognition, and variation in the loop sequences leads to different substrate selectivities between omptins, which makes omptins an ideal platform to investigate functional adaptation and to alter their polypeptide substrate preferences. The omptins Pla of Y. pestis and PgtE of S. enterica are 75% identical in their amino acid sequences. Pla is a multifunctional protein with proteolytic and non-proteolytic functions, and it increases bacterial penetration and proliferation in the host. Functions of PgtE increase migration of S. enterica in vivo and bacterial survival in mouse macrophages, thus enhancing bacterial spread within the host. Mammalian plasminogen/fibrinolytic system maintains the balance between coagulation and fibrinolysis and participates in several cellular processes, e.g., cell migration and degradation of extracellular matrix proteins. This system consists of activation cascades, which are strictly controlled by several regulators, such as plasminogen activator inhibitor 1 (PAI-1), α2-antiplasmin (α2AP), and thrombin-activatable fibrinolysis inhibitor (TAFI). This work reveals novel interactions of the omptins of Y. pestis and S. enterica with the regulators of the plasminogen/fibrinolytic system: Pla and PgtE inactivate PAI-1 by cleavage at the reactive site peptide bond, and degrade TAFI, preventing its activation to TAFIa. Structure-function relationship studies with Pla showed that threonine 259 of Pla is crucial in plasminogen activation, as it prevents degradation of the plasmin catalytic domain by the omptin and thus maintains plasmin stability. In this work I constructed chimeric proteins between Pla and Epo of Erwinia pyrifoliae that share 78% sequence identity to find out which amino acids and regions in Pla are important for its functions. Epo is neither a plasminogen activator nor an invasin, but it degrades α2AP and PAI-1. Cumulative substitutions towards Pla sequence turned Epo into a Pla-like protein. In addition to threonine 259, loops 3 and 5 are critical in plasminogen activation by Pla. Turning Epo into an invasin required substitution of 31 residues located at the extracellular side of the Epo protein above the lipid bilayer, and also of the β1-strand in the N-terminal transmembrane region of the protein. These studies give an example of how omptins adapt to novel functions that advantage their host bacteria in different ecological niches.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The genome sequence of Caloramator mitchellensis strain VF08, a rod-shaped, heterotrophic, strictly anaerobic bacterium iso-lated from the free-flowing waters of a Great Artesian Basin (GAB) bore well located in Mitchell, an outback Queensland town in Australia, is reported here. The analysis of the 2.42-Mb genome sequence indicates that the attributes of the genome are consistent with its physiological and phenotypic traits.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Evolutionary genetics incorporates traditional population genetics and studies of the origins of genetic variation by mutation and recombination, and the molecular evolution of genomes. Among the primary forces that have potential to affect the genetic variation within and among populations, including those that may lead to adaptation and speciation, are genetic drift, gene flow, mutations and natural selection. The main challenges in knowing the genetic basis of evolutionary changes is to distinguish the adaptive selection forces that cause existent DNA sequence variants and also to identify the nucleotide differences responsible for the observed phenotypic variation. To understand the effects of various forces, interpretation of gene sequence variation has been the principal basis of many evolutionary genetic studies. The main aim of this thesis was to assess different forms of teleost gene sequence polymorphisms in evolutionary genetic studies of Atlantic salmon (Salmo salar) and other species. Firstly, the level of Darwinian adaptive evolution affected coding regions of the growth hormone (GH) gene during the teleost evolution was investigated based on the sequence data existing in public databases. Secondly, a target gene approach was used to identify within population variation in the growth hormone 1 (GH1) gene in salmon. Then, a new strategy for single nucleotide polymorphisms (SNPs) discovery in salmonid fishes was introduced, and, finally, the usefulness of a limited number of SNP markers as molecular tools in several applications of population genetics in Atlantic salmon was assessed. This thesis showed that the gene sequences in databases can be utilized to perform comparative studies of molecular evolution, and some putative evidence of the existence of Darwinian selection during the teleost GH evolution was presented. In addition, existent sequence data was exploited to investigate GH1 gene variation within Atlantic salmon populations throughout its range. Purifying selection is suggested to be the predominant evolutionary force controlling the genetic variation of this gene in salmon, and some support for gene flow between continents was also observed. The novel approach to SNP discovery in species with duplicated genome fragments introduced here proved to be an effective method, and this may have several applications in evolutionary genetics with different species - e.g. when developing gene-targeted markers to investigate quantitative genetic variation. The thesis also demonstrated that only a few SNPs performed highly similar signals in some of the population genetic analyses when compared with the microsatellite markers. This may have useful applications when estimating genetic diversity in genes having a potential role in ecological and conservation issues, or when using hard biological samples in genetic studies as SNPs can be applied with relatively highly degraded DNA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Visual pigments of different animal species must have evolved at some stage to match the prevailing light environments, since all visual functions depend on their ability to absorb available photons and transduce the event into a reliable neural signal. There is a large literature on correlation between the light environment and spectral sensitivity between different fish species. However, little work has been done on evolutionary adaptation between separated populations within species. More generally, little is known about the rate of evolutionary adaptation to changing spectral environments. The objective of this thesis is to illuminate the constraints under which the evolutionary tuning of visual pigments works as evident in: scope, tempo, available molecular routes, and signal/noise trade-offs. Aquatic environments offer Nature s own laboratories for research on visual pigment properties, as naturally occurring light environments offer an enormous range of variation in both spectral composition and intensity. The present thesis focuses on the visual pigments that serve dim-light vision in two groups of model species, teleost fishes and mysid crustaceans. The geographical emphasis is in the brackish Baltic Sea area with its well-known postglacial isolation history and its aquatic fauna of both marine and fresh-water origin. The absorbance spectrum of the (single) dim-light visual pigment were recorded by microspectrophotometry (MSP) in single rods of 26 fish species and single rhabdoms of 8 opossum shrimp populations of the genus Mysis inhabiting marine, brackish or freshwater environments. Additionally, spectral sensitivity was determined from six Mysis populations by electroretinogram (ERG) recording. The rod opsin gene was sequenced in individuals of four allopatric populations of the sand goby (Pomatoschistus minutus). Rod opsins of two other goby species were investigated as outgroups for comparison. Rod absorbance spectra of the Baltic subspecies or populations of the primarily marine species herring (Clupea harengus membras), sand goby (P. minutus), and flounder (Platichthys flesus) were long-wavelength-shifted compared to their marine populations. The spectral shifts are consistent with adaptation for improved quantum catch (QC) as well as improved signal-to-noise ratio (SNR) of vision in the Baltic light environment. Since the chromophore of the pigment was pure A1 in all cases, this has apparently been achieved by evolutionary tuning of the opsin visual pigment. By contrast, no opsin-based differences were evident between lake and sea populations of species of fresh-water origin, which can tune their pigment by varying chromophore ratios. A more detailed analysis of differences in absorbance spectra and opsin sequence between and within populations was conducted using the sand goby as model species. Four allopatric populations from the Baltic Sea (B), Swedish west coast (S), English Channel (E), and Adriatic Sea (A) were examined. Rod absorbance spectra, characterized by the wavelength of maximum absorbance (λmax), differed between populations and correlated with differences in the spectral light transmission of the respective water bodies. The greatest λmax shift as well as the greatest opsin sequence difference was between the Baltic and the Adriatic populations. The significant within-population variation of the Baltic λmax values (506-511 nm) was analyzed on the level of individuals and was shown to correlate well with opsin sequence substitutions. The sequences of individuals with λmax at shorter wavelengths were identical to that of the Swedish population, whereas those with λmax at longer wavelengths additionally had substitution F261F/Y in the sixth transmembrane helix of the protein. This substitution (Y261) was also present in the Baltic common gobies and is known to redshift spectra. The tuning mechanism of the long-wavelength type Baltic sand gobies is assumed to be the co-expression of F261 and Y261 in all rods to produce ≈ 5 nm redshift. The polymorphism of the Baltic sand goby population possibly indicates ambiguous selection pressures in the Baltic Sea. The visual pigments of all lake populations of the opossum shrimp (Mysis relicta) were red-shifted by 25 nm compared with all Baltic Sea populations. This is calculated to confer a significant advantage in both QC and SNR in many humus-rich lakes with reddish water. Since only A2 chromophore was present, the differences obviously reflect evolutionary tuning of the visual protein, the opsin. The changes have occurred within the ca. 9000 years that the lakes have been isolated from the Sea after the most recent glaciation. At present, it seems that the mechanism explaining the spectral differences between lake and sea populations is not an amino acid substitution at any other conventional tuning site, but the mechanism is yet to be found.