Gut ischemia/reperfusion induced acute lung injury is an alveolar macrophage dependent event

Background:. Although the role of the lung alveolar macrophage (AM) as a mediator of acute lung injury (ALI) after lung ischemia/reperfusion (I/R) has been suggested by animal experiments, it has not been determined whether AMs mediate ALI after intestinal I/R. The objective of this study was to determine the effect of AM elimination on ALI after intestinal I/R in rats. Mwthods: Male Wistar rats (n = 90) were randomly divided into three groups: the clodronate-liposomes (CLOD-LIP) group received intratracheal treatment with CLOD-LIP; the liposomes (LIP) group received intratracheal treatment with LIP; and the nontreated (UNTREAT) group received no treatment. Twenty-four hours later each group was randomly divided into three subgroups: the intestinal I/R subgroup was subjected to 45-minute intestinal ischemia and 2-hour reperfusion; the laparotomy (LAP) subgroup was subjected to LAP and sham procedures; the control (CTR) subgroup received no treatment. At the end of reperfusion, ALI was quantitated in all the animals by the Evans blue dye (EBD) method. Results: ALI values are expressed as EBD lung leakage (mu g EBD/g dry lung weight). EBD lung leakage values in the CLOD-LIP group were 32.59 +/- 12.74 for I/R, 27.74 +/- 7.99 for LAP, and 33.52 +/- 10.17 for CTR. In the LIP group, lung leakage values were 58.02 +/- 18.04 for I/R, 31.90 +/- 8.72 for LAP, and 27.17 +/- 11.48 for CTR. In the UNTREAT group, lung leakage values were 55.60 +/- 10.96 for I/R, 35.99 +/- 6.89 for LAP, and 30.83 +/- 8.41 for CTR. Within each group, LAP values did not differ from CTR values. However, in the LIP and UNTREAT groups, values for both the LAP and CTR subgroups were lower than values for the I/R subgroup (p < 0.001). The CLOD-LIP I/R subgroup value was less (p < 0.001) than the I/R subgroup values in the LIP and UNTREAT groups. These results indicated that I/R provokes ALI that can be prevented by CLOD-LIP treatment, and further suggested that AMs are essential for ALI occurrence induced by intestinal I/R in rats.

Mathematical constraints on a theory of human memory - Response

Colonius suggests that, in using standard set theory as the language in which to express our computational-level theory of human memory, we would need to violate the axiom of foundation in order to express meaningful memory bindings in which a context is identical to an item in the list. We circumvent Colonius's objection by allowing that a list item may serve as a label for a context without being identical to that context. This debate serves to highlight the value of specifying memory operations in set theoretic notation, as it would have been difficult if not impossible to formulate such an objection at the algorithmic level.

Reconstruction of large cranial defects in nonimmunosuppressed experimental design with human dental pulp stem cells

The main aim of this study is to evaluate the capacity of human dental pulp stem cells (hDPSC), isolated from deciduous teeth, to reconstruct large-sized cranial bone defects in nonimmunosuppressed (NIS) rats. To our knowledge, these cells were not used before in similar experiments. We performed two symmetric full-thickness cranial defects (5 x 8 mm) on each parietal region of eight NIS rats. In six of them, the left side was supplied with collagen membrane only and the right side (RS) with collagen membrane and hDPSC. In two rats, the RS had collagen membrane only and nothing was added at the left side (controls). Cells were used after in vitro characterization as mesenchymal cells. Animals were euthanized at 7, 20, 30, 60, and 120 days postoperatively and cranial tissue samples were taken from the defects for histologic analysis. Analysis of the presence of human cells in the new bone was confirmed by molecular analysis. The hDPSC lineage was positive for the four mesenchymal cell markers tested and showed osteogenic, adipogenic, and myogenic in vitro differentiation. We observed bone formation 1 month after surgery in both sides, but a more mature bone was present in the RS. Human DNA was polymerase chain reaction-amplified only at the RS, indicating that this new bone had human cells. The us e of hDPSC in NIS rats did not cause any graft. rejection. Our findings suggest that hDPSC is an additional cell resource for correcting large cranial defects in rats and constitutes a promising model for reconstruction of human large cranial defects in craniofacial surgery.

Effects of (-)-RO363 at human atrial beta-adrenoceptor subtypes, the human cloned beta(3)-adrenoceptor and rodent intestinal beta(3)-adrenoceptors

1 Chronic treatment of patients with beta-blockers causes atrial inotropic hyperresponsiveness through beta(2)-adrenoceptors, 5-HT4 receptors and H-2-receptors but apparently not through beta(1)-adrenoceptors despite data claiming an increased beta(1)-adrenoceptor density from homogenate binding studies. We have addressed the question of beta(1)-adrenoceptor sensitivity by determining the inotropic potency and intrinsic activity of the beta(1)-adrenoceptor selective partial agonist (-)-RO363 and by carrying out both homogenate binding and quantitative beta-adrenoceptor autoradiography in atria obtained from patients treated or not treated with beta-blockers. In the course of the experiments it became apparent that (-)-RO363 also may cause agonistic effects through the third atrial beta-adrenoceptor. To assess whether (-)-RO363 also caused agonistic effects through beta(3)-adrenoceptors we studied its relaxant effects in rat colon and guinea-pig ileum, as well as receptor binding and adenylyl cyclase stimulation of chinese hamster ovary (CHO) cells expressing human beta(3)-adrenoceptors. 2 beta-Adrenoceptors were labelled with (-)-[I-125]-cyanopindolol. The density of both beta(1)- and beta(2)-adrenoceptors was unchanged in the 2 groups, as assessed with both quantitative receptor autoradiography and homogenate binding. The affinities of (-)-RO363 for beta(1)-adrenoceptors (pK(i) = 8.0-7.7) and beta(2)-adrenoceptors (pK(i) = 6.1-5.8) were not significantly different in the two groups. 3 (-)-RO363 increased atrial force with a pEC(50) of 8.2 (beta-blocker treated) and 8.0 (non-beta-blocker treated) and intrinsic activity with respect to (-)-isoprenaline of 0.80 (beta-blocker treated) and 0.54 (non-beta-blocker treated) (P<0.001) and with respect to Ca2+ (7 mM) of 0.65 (beta-blocker treated) and 0.45 (non-beta-blocker treated) (P<0.01). The effects of (-)-RO363 were resistant to antagonism by the beta(2)-adrenoceptor antagonist, ICI 118,551 (50 nM). The effects of 0.3-10 nM (-)-RO363 were antagonized by 3-10 nM of the beta(1)-adrenoceptor selective antagonist CGP 20712A. The effects of 20-1000 nM (-)-RO363 were partially resistant to antagonism by 30-300 nM CGP 20712A. 4 (-)-RO363 relaxed the rat colon, partially precontracted by 30 mM KCl, with an intrinsic activity of 0.97 compared to (-)-isoprenaline. The concentration-effect curve to (-)-RO363 revealed 2 components, one antagonized by (-)-propranolol (200 nM) with pEC(50)=8.5 and fraction 0.66, the other resistant to (-)-propranolol (200 nM) with pEC(50)=5.6 and fraction 0.34 of maximal relaxation. 5 (-)-RO363 relaxed the longitudinal muscle of guinea-pig ileum, precontracted by 0.5 mu M histamine, with intrinsic activity of 1.0 compared to (-)-isoprenaline and through 2 components, one antagonized by (-)-propranolol (200 nM) with pEC(50)=8.7 and fraction 0.67, the other resistant to (-)-propranolol with pEC(50)=4.9 and fraction 0.33 of maximal relaxation. 6 (-)-RO363 stimulated the adenylyl cyclase of CHO cells expressing human beta(3)-adrenoceptors with pEC(50)=5.5 and intrinsic activity 0.74 with respect to (-)-isoprenaline (pEC(50)=5.9). (-)-RO363 competed for binding with [I-125]cyanopindolol at human beta(3)-adrenoceptors transfected into CHO cells with pK(i)=4.5. (-)-Isoprenaline (pk(i)=5.2) and (-)-CGP 12177A (pK(i)=6.1) also competed for binding at human beta(2)-adrenoceptors. 7 We conclude that under conditions used in this study, (-)-RO363 is a potent partial agonist for human beta(1)- and beta(3)-adrenoceptors and appears also to activate the third human atrial beta-adrenoceptor. (-)-RO363 relaxes mammalian gut through both beta(1)- and beta(3)-adrenoceptors. (-)-RO363, used as a beta(1)-adrenoceptor selective tool, confirms previous findings with (-)-noradrenaline that beta(1)-adrenoceptor mediated atrial effects are only slightly enhanced by chronic treatment of patients with beta-blockers. Chronic treatment with beta(1)-adrenoceptor-selective blockers does not significantly increase the density of human atrial beta(1)- and beta(2)-adrenoceptors.

Molecular adjuvant effects of a conformationally biased agonist elf human C5a anaphylatoxin

A conformationally biased decapeptide agonist of human C5a anaphylatoxin (YSFKPMPLaR) was used as a molecular adjuvant in stimulating Ab responses against peptide epitopes derived from human MUC1 glycoprotein and the human mu and kappa opioid receptors. C57BL6 mice were immunized with the MUC1 epitope (YKQGGFLGL); the C5a agonist (YSFKPMPLaR); YSFKPMPLaR and YKQGGFLGL together, but unconjugated; a C5a-active, MUC1 epitope construct (YKQGGFLGLYSFKPMPLaR); and a C5a-inactive, reversed moiety construct (YSFKPMPLaRYKQGGFLGL). High Ab titers specific for the MUC1 epitope were observed Only in mice immunized with the C5a-active epitope construct. Similar results were obtained in BALB/c mice immunized with the C5a-active, MUC1 epitope construct, Abs from the sera of the C57BL6 mice were predominately of the IgG2a, IgC2b, and IgM isotypes and were reactive against human recombinant MUC1 and MUC1 expressed by the Panc-1 M1F.15 pancreatic cell line, When compared with the corresponding KLH-epitope conjugates in C57BL6 mice, the epitope-C5a agonist constructs produced titers of specific IgG Abs of isotypes distinct from those generated by the keyhole limpet hemocyanin-epitope conjugates, Rabbits immunized with a mu opioid receptor epitope-C5a agonist construct (GDLSDPCGNRTNLGGRDSLYSFKPMPLaR) or a kappa opioid receptor epitope-C5a agonist construct (FPGWAEPDSNGSEDAQLYSFKPMPLaR) generated high titer, epitope-specific Ab responses, Ab titers generated in response to the opioid epitope-C5a agonist constructs were comparable to those generated by the opioid KLH-epitope conjugates, The results of this study are discussed in terms of possible mechanisms by which the conformationally biased C5a agonist serves as a molecular adjuvant.

Evaluation of Maxillary Alveolar Reconstruction Using a Resorbable Collagen Sponge with Recombinant Human Bone Morphogenetic Protein-2 in Cleft Lip and Palate Patients

Introduction: A resorbable collagen matrix with recombinant human bone morphogenetic protein (rhBMP-2) was compared with traditional iliac crest bone graft for the closure of alveolar defects during secondary dental eruption. Methods: Sixteen patients with unilateral cleft lip and palate, aged 8 to 12 years, were selected and randomly assigned to group 1 (rhBMP-2) or group 2 (iliac crest bone graft). Computed tomography was performed to assess both groups preoperatively and at months 6 and 12 postoperatively. Bone height and defect volume were calculated through Osirix Dicom Viewer (Pixmeo, Apple Inc.). Overall morbidity was recorded. Results: Preoperative and follow-up examinations revealed progressive alveolar bone union in all patients. For group 1, final completion of the defect with a 65.0% mean bone height was detected 12 months postoperatively. For group 2, final completion of the defect with an 83.8% mean bone height was detected 6 months postoperatively. Dental eruption routinely occurred in both groups. Clinical complications included significant swelling in three group 1 patients (37.5%) and significant donor-site pain in seven group 2 patients (87.5%). Conclusions: For this select group of patients with immature skeleton, rhBMP-2 therapy resulted in satisfactory bone healing and reduced morbidity compared with traditional iliac crest bone grafting.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Pentoxifylline modifies three-dimensional collagen lattice model contraction and expression of collagen types I and III by human fibroblasts derived from post-burn hypertrophic scars and from normal skin

Fibroblasts are thought to be partially responsible for the persisting contractile forces that result in burn contractures. Using a monolayer cell culture and fibroblast populated collagen lattice (FPCL) three-dimensional model we subjected hypertrophic scar and non-cicatricial fibroblasts to the antifibrogenic agent pentoxifylline (PTF - 1 mg/mL) in order to reduce proliferation, collagen types I and III synthesis and model contraction. Fibroblasts were isolated from post-burn hypertrophic scars (HSHF) and non-scarred skin (NHF). Cells were grown in monolayers or incorporated into FPCL`s and exposed to PTF. In monolayer, cell number proliferation was reduced (46.35% in HSHF group and 37.73% in NHF group, p < 0.0001). PTF selectively inhibited collagen III synthesis in the HSHF group while inhibition was more evident to type I collagen synthesis in the NHF group. PTF also reduced contraction in both (HSHF and NHF) FPCL. (C) 2009 Elsevier Ltd and ISBI. All rights reserved.

Protein disulfide isomerase redox-dependent association with p47(phox): evidence for an organizer role in leukocyte NADPH oxidase activation

Mechanisms of leukocyte NADPH oxidase regulation remain actively investigated. We showed previously that vascular and macrophage oxidase complexes are regulated by the associated redox chaperone PDI. Here, we investigated the occurrence and possible underlying mechanisms of PDI-mediated regulation of neutrophil NADPH oxidase. In a semirecombinant cell-free system, PDI inhibitors scrRNase (100 mu g/mL) or bacitracin (1 mM) near totally suppressed superoxide generation. Exogenously incubated, oxidized PDI increased (by similar to 40%), whereas PDIred diminished (by similar to 60%) superoxide generation. No change occurred after incubation with PDI serine-mutated in all four redox cysteines. Moreover, a mimetic CxxC PDI inhibited superoxide production by similar to 70%. Thus, oxidized PDI supports, whereas reduced PDI down-regulates, intrinsic membrane NADPH oxidase complex activity. In whole neutrophils, immunoprecipitation and colocalization experiments demonstrated PDI association with membrane complex subunits and prominent thiol-mediated interaction with p47(phox) in the cytosol fraction. Upon PMA stimulation, PDI was mobilized from azurophilic granules to cytosol but did not further accumulate in membranes, contrarily to p47(phox). PDI-p47(phox) association in cytosol increased concomitantly to opposite redox switches of both proteins; there was marked reductive shift of cytosol PDI and maintainance of predominantly oxidized PDI in the membrane. Pulldown assays further indicated predominant association between PDIred and p47(phox) in cytosol. Incubation of purified PDI (> 80% reduced) and p47(phox) in vitro promoted their arachidonate-dependent association. Such PDI behavior is consistent with a novel cytosolic regulatory loop for oxidase complex (re) cycling. Altogether, PDI seems to exhibit a supportive effect on NADPH oxidase activity by acting as a redox-dependent enzyme complex organizer. J. Leukoc. Biol. 90: 799-810; 2011.

Macrophage Activation Syndrome Associated with Etanercept in a Child with Systemic Onset juvenile Idiopathic Arthritis

Fundacao de Amparo a Pesquisa do Estado de Sao Paulo - FAPESP[06/61303-7]

Biologically active conformer of the effector region of human C5a and modulatory effects of N-terminal receptor binding determinants on activity

A conformationally biased decapeptide agonist of human C5a (C5a(65-74)Y65,F67,P69,P71,D-Ala73 or YSFKPMPLaR) was used as a functional probe of the C5a receptor (C5aR) in order to understand the conformational features in the C-terminal effector region of C5a that are important for C5aR binding and signal transduction. YSFKPMPLaR was a potent, full agonist of C5a, but at higher concentrations had a superefficacious effect compared to the natural factor. The maximal efficacy of this analogue was 216 +/- 56% that of C5a in stimulating the release of beta-glucuronidase from human neutrophils. C5aR activation and binding curves both occurred in the same concentration range with YSFKPMPLaR, characteristics not observed with natural C5a or more conformationally flexible C-terminal agonists. YSFKPMPLaR was then used as a C-terminal effector template onto which was synthesized various C5aR binding determinants from the N-terminal core domain of the natural factor. In general, the presence of N-terminal binding determinants had little effect on either potency or binding affinity when the C-terminal effector region was presented to the C5aR in this biologically active conformation. However, one peptide, C5a(12-20)-Ahx-YSFKPMPLaR, expressed a 100-fold increase in affinity for the neutrophil C5aR and a 6-fold increase in potency relative to YSFKPMPLaR. These analyses showed that the peptides used in this study have up to 25% of the potency of C5a in human fetal artery and up to 5% of the activity of C5a in the PMN enzyme release assay.

Serum from children with polyarticular juvenile idiopathic arthritis (pJIA) inhibits differentiation, mineralization and may increase apoptosis of human osteoblasts ""in vitro""

We examined the effects of polyarticular juvenile idiopathic arthritis (pJIA) serum on proliferation, differentiation, mineralization, and apoptosis of human osteoblast cells (hOb) in culture. The hOb were cultured with 10% serum from active pJIA and healthy controls (CT) and were tested for DNA synthesis, alkaline phosphatase (AP) activity, osteocalcin (OC) secretion, calcium levels, caspase 3 activity, and DNA fragmentation. None of the patients had used glucocorticoids for at least 1 month before the study, or any other drug that can affect bone mineral metabolism. Human inflammatory cytokine levels (IL-6, IL-8, IL-10, IL-1 beta, TNF-alpha, and IL-12p70) were measured in pJIA and CT sera. Low levels of AP activity was observed in pJIA cultures compared with CT cultures (67.16 +/- 53.35 vs 100.11 +/- 50.64 mu mol p-nitrophenol/h(-1) mg(-1) protein, P=0.008). There was also a significant decrease in OC secretion (9.23 +/- 5.63 vs 12.82 +/- 7.02 ng/mg protein, P=0.012) and calcium levels (0.475 +/- 0.197 vs 0.717 +/- 0.366 mmol/l, P=0.05) in pJIA hOb cultures. No difference was observed in cell proliferation (323.56 +/- 108.23 vs 328.91 +/- 88.03 dpm/mg protein, P=0.788). Osteoblasts cultured with JIA sera showed lower levels of DNA and increased fragmentation than osteoblasts cultured with CT sera. pJIA sera showed higher IL-6 values than CT (21.44 +/- 9.31 vs 3.58 +/- 2.38 pg/ml, P<0.001), but no difference was observed related to IL-8, IL-10, IL-1 beta, TNF-alpha, and IL-12p70 between pJIA and controls. This study suggests that serum from children with pJIA inhibits differentiation, mineralization and may increase apoptosis of hOb cultures, and inflammatory cytokines such as IL-6 might be a mechanism in this find. These results may represent an alternative therapeutic target for prevention and treatment of bone loss in JIA.

Aerobic Exercise Improves Reverse Cholesterol Transport in Cholesteryl Ester Transfer Protein Transgenic Mice

We analyzed the effect of a 6-week aerobic exercise training program on the in vivo macrophage reverse cholesterol transport (RCT) in human cholesteryl ester transfer protein (CETP) transgenic (CETP-tg) mice. Male CETP-tg mice were randomly assigned to a sedentary group or a carefully supervised exercise training group (treadmill 15 m/min, 30 min sessions, five sessions per week). The levels of plasma lipids were determined by enzymatic methods, and the lipoprotein profile was determined by fast protein liquid chromatography (FPLC). CETP activity was determined by measuring the transfer rate of (14)C-cholesterol from HDL to apo-B containing lipoproteins, using plasma from CETP-tg mice as a source of CETP. The reverse cholesterol transport was determined in vivo by measuring the [(3)H]-cholesterol recovery in plasma and feces (24 and 48 h) and in the liver (48 h) following a peritoneal injection of [(3)H]-cholesterol labeled J774-macrophages into both sedentary and exercise trained mice. The protein levels of liver receptors were determined by immunoblot, and the mRNA levels for liver enzymes were measured using RT-PCR. Exercise training did not significantly affect the levels of plasma lipids or CETP activity. The HDL fraction assessed by FPLC was higher in exercise-trained compared to sedentary mice. In comparison to the sedentary group, a greater recovery of [(3)H]-cholesterol from the injected macrophages was found in the plasma, liver and feces of exercise-trained animals. The latter occurred even with a reduction in the liver CYP7A1 mRNA level in exercised trained animals. Exercise training increased the liver LDL receptor and ABCA-1 protein levels, although the SR-BI protein content was unchanged. The RCT benefit in CETP-tg mice elicited by exercise training helps to elucidate the role of exercise in the prevention of atherosclerosis in humans.