992 resultados para 143-870B


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Three ponies continuously grazed a pasture containing an estimated 24% Indigofera spicata (wet weight basis) for 4–6 weeks in April and May 2004. They developed ataxia, paresis, depression, muscle fasciculations, dysphagia, ptyalism and halitosis. Two also developed corneal opacity. One pony recovered with supportive treatment, but the other two were euthanased and necropsied. Neuropathology was not present in either case, but both livers had periacinar and periportal lymphocytic infiltrations and hydropic degeneration of mid-zonal hepatocytes, with mild to moderate periacinar necrosis also evident in one. The I. spicata contained 2.66 mg 3-nitropropionic acid (3-NPA)/g dry matter and 1.5 mg indospicine/g dry matter. Indospicine, but not 3-NPA, was detected in serum from both of the euthanased ponies and indospicine was detected in heart, liver and muscle from the one pony in which this assay was performed. The clinical syndrome closely resembled ‘Birdsville horse disease’ caused by I. linnaei and was similar to that reported in horses poisoned by the closely related species I. hendecaphylla and to 3-NPA poisoning of other animals, including humans. 3-NPA is thought to cause this neurological syndrome. To our knowledge, this is the first authenticated report of I. spicata poisoning in grazing animals. We also report here the first published evidence that 3-NPA and indospicine exist in naturalised I. spicata in Australia and of the formation of indospicine residues in tissues of animals grazing paddocks infested with I. spicata.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The electrical activation energy and optical band-gap of GeSe and GeSbSe thin films prepared by flash evaporation on to glass substrates have been determined. The conductivities of the films were found to be given by Image , the activation energy Ea being 0.53 eV and 0.40 eV for GeSe and GeSbSe respectively. The optical absorption constant α near the absorption edge could be described by Image from which the optical band-gaps E0 were found to be 1.01 eV for GeSe and 0.67 eV for GeSbSe at 300°K. At 110°K the corresponding values of E0 were 1.07 eV and 0.735 eV respectively. The significance of these values is discussed in relation to those of other amorphous semiconductors.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

M r=670.02, monoclinic, C2/c, a= 31.003(4), b=11.037(2), c=21.183(3)A, fl= 143.7 (1) °, V= 4291.2/k 3, D,n = 2.06, D x = 2.07Mgm -3, Z=8, MoKa, 2=0.7107/k, /~=7.45 mm -1, F(000) = 2560, T= 293 K, R = 0.061 for 1697 observed reflections. The bromphenol blue molecule consists essentially of three planar groupings: the sulfonphthalein ring system and two dibromophenol rings attached to the tetrahedral C atom of the five-membered ring of the sulfonphthalein system. The dibromophenol rings are inclined with resPect to each other at 73 ° whereas they make angles of 85 and 68 ° with respect to the sulfonphthalein system. The molecules aggregate into helical columns with the non-polar regions of the molecules in the interior and the polar regions on the surface. The columns are held together by a network of hydrogen bonds.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Townsend's first ionization coefficients have been measured in corssed electric and magnetic fields for values of B/p ranging from 0.013 TESLA. TORR-1 to 0.064 TESLA.TORR-1 and for 103 x 102¿ E/p 331 x 102 V.M-1. TORR-1 in oxygen and for 122 x 102¿ E/pÂ488 x 102 V.M-1.TORR-1 for dry air. The values of effective collision frequencies determined from the equivalent pressure (pe) concept generally increase with E/p at constant B/p and decrease with increasing B/p at constant E/p. Effective collision frequencies determined from measured sparking potentials at high values of E/p increase with decreasing E/pe. The drift velocity and mean energy of electrons in oxygen in crossed electric and magnetic fields have been derived.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Abstract is not available.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Crystalline complexes of succinic acid with DL- and L-lysine have been prepared and analysed by X-ray diffraction. DL-Lysine complex: C6HIsN202 + 1 2- 1 ~C4H404 .~C4H604, Mr -- 264"2, PI, a = 5"506 (4), =8.070(2), c=14.089(2) A,, a=92.02(1), /3= 100"69 (3), y = 95"85 (3) ~>, Z = 2, Dx = 1"44 g cm -3, R = 0.059 for 2546 observed reflections. Form I of the e-lysine complex: C6HIsN20-, ~ .C4H504, Mr = 264.2, P1, a = 5" 125 (2), b = 8"087 (1), c = 8"689 (1) A,, a = 112.06 (1), /3 = 99.08 (2), y = 93"77(2) °, Z--l, D,,,=1"34(3), Dx=l"34gcm 3 R = 0.033 for 1475 observed reflections. Form II of + I 2- the e-lysine complex: C6H15N202 .,iC4H404 .- 1 I ") 4C4H604.4(C4HsO4""H'"CaH404)" , Mr = 264"2, P1, a = 10.143 (4), b = 10.256 (2), c = 12"916 (3) A,, a = 105.00 (2),/3 = 99-09 (3), y = 92"78 (3)::, Z = 4, Dm= 1"37(4), D,.= 1.38gcm 3, R=0.067 for 2809 observed reflections. The succinic acid molecules in the structures exhibit a variety of ionization states. Two of the lysine conformations found in the complexes have been observed for the first time in crystals containing lysine. Form II of the L-lysine complex is highly pseudosymmetric. In all the complexes, unlike molecules aggregate into separate alternating layers. The basic element of aggregation in the lysine layer in the complexes is an S2-type head-to-tail sequence. This element combines in different ways in the three structures. The basic element of aggre gation in the succinic acid layer in the complexes is a hydrogen-bonded ribbon. The ribbons are interconnected indirectly through amino groups in the lysine layer.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This paper asks a new question: how we can use RFID technology in marketing products in supermarkets and how we can measure its performance or ROI (Return-on-Investment). We try to answer the question by proposing a simulation model whereby customers become aware of other customers' real-time shopping behavior and may hence be influenced by their purchases and the levels of purchases. The proposed model is orthogonal to sales model and can have the similar effects: increase in the overall shopping volume. Managers often struggle with the prediction of ROI on purchasing such a technology, this simulation sets to provide them the answers of questions like the percentage of increase in sales given real-time purchase information to other customers. The simulation is also flexible to incorporate any given model of customers' behavior tailored to particular supermarket, settings, events or promotions. The results, although preliminary, are promising to use RFID technology for marketing products in supermarkets and provide several dimensions to look for influencing customers via feedback, real-time marketing, target advertisement and on-demand promotions. Several other parameters have been discussed including the herd behavior, fake customers, privacy, and optimality of sales-price margin and the ROI of investing in RFID technology for marketing purposes. © 2010 Springer Science+Business Media B.V.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The PRP17 gene product is required for the second step of pre-mRNA splicing reactions. The C-terminal half of this protein bears four repeat units with homology to the beta transducin repeat. Missense mutations in three temperature-sensitive prp17 mutants map to a region in the N-terminal half of the protein. We have generated, in vitro, 11 missense alleles at the beta transducin repeat units and find that only one affects function in vivo. A phenotypically silent missense allele at the fourth repeat unit enhances the slow-growing phenotype conferred by an allele at the third repeat, suggesting an interaction between these domains. Although many missense mutations in highly conserved amino acids lack phenotypic effects, deletion analysis suggests an essential role for these units. Only mutations in the N-terminal nonconserved domain of PRP17 are synthetically lethal in combination with mutations in PRP16 and PRP18, two other gene products required for the second splicing reaction. A mutually allele-specific interaction between Prp17 and snr7, with mutations in U5 snRNA, was observed. We therefore suggest that the functional region of Prp17p that interacts with Prp18p, Prp16p, and U5 snRNA is the N terminal region of the protein.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Biosensors have gained immense acceptance in the field of medical diagnostics, besides environmental, food safety and biodefence applications due to its attributes of real-time and rapid response. This synergistic combination of biotechnology and microelectronics comprises a biological recognition element coupled with a compatible transducer device. Diabetes is a disease of major concern since the ratio of world population suffering from it is increasing at an alarming rate and therefore the need for development of accurate and stable glucose biosensors is evident. There are many commercial glucose biosensors available yet some limitations need attention. This review presents a detailed account of the polypyrrole based amperometric glucose biosensors. The polymer polypyrrole is used extensively as a matrix for immobilization of glucose oxidase enzyme owing to its favourable features such as stability under ambient conditions, conductivity that allows it to be used as an electron relay, ability to be polymerized under neutral and aqueous mild conditions, and more. The simple one-step electrodeposition on the electrode surface allows easy entrapment of the enzyme. The review is structured into three categories (a) the first-stage biosensors: which report the studies from the inception of use of polypyrrole in glucose biosensors during which time the role of the polymer and the use of mediators was established. This period saw extensive work by two separate groups of Schuhmann and Koopal who contributed a great deal in understanding the electron transfer pathways in polypyrrole based glucose biosensors, (b) the second-stage biosensors: which highlight the shift of polypyrrole from a conventional matrix to composite matrices with extensive use of mediators focused at improving the selectivity of response, and (c) third-stage biosensors: the remarkable properties of nanoparticles and carbon nanotubes and their outstanding ability to mediate electrontransfers have seen their indispensable use in conjugation with polypyrrole for development of glucose biosensors with improved sensitivity and stability characteristics which is accounted in the review, which thus traces the evolution of polypyrrole from a conventional matrix, to composites and thence to the form of nanotube arrays, with the objective of addressing the vital issue of diabetes management through the development of stable and reliable glucose biosensors.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Description of the work Shrinking Violets is comprised of two half scale garments in laser cut silk organza, developed with a knotting device to allow for disassembly and reassembly. The first is a jacket in layered red organza including black storm flap details. The second is a vest in jade organza with circles of pink organza attached through a pattern of knots. Research Background This practice-led fashion design research sits within the field of Design for Sustainability (DfS) in fashion that seeks to mitigate the environmental and ethical impacts of fashion consumption and production. The research explores new systems of garment construction for DfS, and examines how these systems may involve ‘designing’ new user interactions with the garments. The garments’ construction system allows them to be disassembled and recycled or reassembled by users to form a new garment. Conventional garment design follows a set process of cutting and construction, with pattern pieces permanently machine-stitched together. Garments typically contain multiple fibre types; for example a jacket may be constructed from a shell of wool/polyester, an acetate lining, fusible interlinings, and plastic buttons. These complex inputs mean that textile recycling is highly labour intensive, first to separate the garment pieces and second to sort the multiple fibre types. This difficulty results in poor quality ‘shoddy’ comprised of many fibre types and unsuitable for new apparel, or in large quantities of recyclable textile waste sent to landfill (Hawley 2011). Design-led approaches that consider the garment’s end of life in the design process are a way of addressing this problem. In Gulich’s (2006) analysis, use of single materials is the most effective way to ensure ease of recycling, with multiple materials that can be detached next in effectiveness. Given the low rate of technological innovation in most apparel manufacturing (Ruiz 2011), a challenge for effective recycling is how to develop new manufacturing methods that allow for garments to be more easily disassembled at end-of-life. Research Contribution This project addresses the research question: How can design for disassembly be considered within the fashion design process? I have employed a practice-led methodology in which my design process leads the research, making use of methods of fashion design practice including garment and construction research, fabric and colour research, textile experimentation, drape, patternmaking, and illustration as well as more recent methods such as laser cutting. Interrogating the traditional approaches to garment construction is necessarily a technical process; however fashion design is as much about the aesthetic and desirability of a garment as it is about the garment’s pragmatics or utility. This requires a balance between the technical demands of designing for disassembly with the aesthetic demands of fashion. This led to the selection of luxurious, semi-transparent fabrics in bold floral colours that could be layered to create multiple visual effects, as well as the experimentation with laser cutting for new forms of finishing and fastening the fabrics together. Shrinking Violets makes two contributions to new knowledge in the area of design for sustainability within fashion. The first is in the technical development of apparel modularity through the system of laser cut holes and knots that also become a patterning device. The second contribution lies in the design of a system for users to engage with the garment through its ability to be easily reconstructed into a new form. Research Significance Shrinking Violets was exhibited at the State Library of Queensland’s Asia Pacific Design Library, 1-5 November 2015, as part of The International Association of Societies of Design Research’s (IASDR) biannual design conference. The work was chosen for display by a panel of experts, based on the criteria of design innovation and contribution to new knowledge in design. References Gulich, B. (2006). Designing textile products that are easy to recycle. In Y. Wang (Ed.), Recycling in Textiles (pp. 25-37). London: Woodhead. Hawley, J. M. (2011). Textile recycling options: exploring what could be. In A. Gwilt & T. Rissanen (Eds.), Shaping Sustainable Fashion: Changing the way we make and use clothes (pp. 143 - 155). London: Earthscan. Ruiz, B. (2014). Global Apparel Manufacturing. Retrieved 10 August 2014, from http://clients1.ibisworld.com/reports/gl/industry/default.aspx?entid=470

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Acute intermittent porphyria (AIP, MIM #176000) is an inherited metabolic disease due to a partial deficiency of the third enzyme, hydroxymethylbilane synthase (HMBS, EC: 4.3.1.8), in the haem biosynthesis. Neurological symptoms during an acute attack, which is the major manifestation of AIP, are variable and relatively rare, but may endanger a patient's life. In the present study, 12 Russian and two Finnish AIP patients with severe neurological manifestations during an acute attack were studied prospectively from 1995 to 2006. Autonomic neuropathy manifested as abdominal pain (88%), tachycardia (94%), hypertension (75%) and constipation (88%). The most common neurological sign was acute motor peripheral neuropathy (PNP, 81%) often associated with neuropathic sensory loss (54%) and CNS involvement (85%). Despite heterogeneity of the neurological manifestations in our patients with acute porphyria, the major pattern of PNP associated with abdominal pain, dysautonomia, CNS involvement and mild hepatopathy could be demonstrated. If more strict inclusion criteria for biochemical abnormalities (>10-fold increase in excretion of urinary PBG) are applied, neurological manifestations in an acute attack are probably more homogeneous than described previously, which suggests that some of the neurological patients described previously may not have acute porphyria but rather secondary porphyrinuria. Screening for acute porphyria using urinary PBG is useful in a selected group of neurological patients with acute PNP or encephalopathy and seizures associated with pain and dysautonomia. Clinical manifestations and the outcome of acute attacks were used as a basis for developing a 30-score scale of the severity of an acute attack. This scale can easily be used in clinical practice and to standardise the outcome of an attack. Degree of muscle weakness scored by MRC, prolonged mechanical ventilation, bulbar paralysis, impairment of consciousness and hyponatraemia were important signs of a poor prognosis. Arrhythmia was less important and autonomic dysfunction, severity of pain and mental symptoms did not affect the outcome. The delay in the diagnosis and repeated administrations of precipitating factors were the main cause of proceeding of an acute attack into pareses and severe CNS involvement and a fatal outcome in two patients. Nerve conduction studies and needle EMG were performed in eleven AIP patients during an acute attack and/or in remission. Nine patients had severe PNP and two patients had an acute encephalopathy but no clinically evident PNP. In addition to axonopathy, features suggestive of demyelination could be demonstrated in patients with severe PNP during an acute attack. PNP with a moderate muscle weakness was mainly pure axonal. Sensory involvement was common in acute PNP and could be subclinical. Decreased conduction velocities with normal amplitudes of evoked potentials during acute attacks with no clinically evident PNP indicated subclinical polyneuropathy. Reversible symmetrical lesions comparable with posterior reversible encephalopathy syndrome (PRES) were revealed in two patients' brain CT or MRI during an acute attack. In other five patients brain MRI during or soon after the symptoms was normal. The frequency of reversible brain oedema in AIP is probably under-estimated since it may be short-lasting and often indistinguishable on CT or MRI. In the present study, nine different mutations were identified in the HMBS gene in 11 unrelated Russian AIP patients from North Western Russia and their 32 relatives. AIP was diagnosed in nine symptom-free relatives. The majority of the mutations were family-specific and confirmed allelic heterogeneity also among Russian AIP patients. Three mutations, c.825+5G>C, c.825+3_825+6del and c.770T>C, were novel. Six mutations, c.77G>A (p.R26H), c.517C>T (p.R173W), c.583C>T (p.R195C), c.673C>T (p.R225X), c.739T>C (p.C247R) and c.748G>C (p.E250A), have previously been identified in AIP patients from Western and other Eastern European populations. The effects of novel mutations were studied by amplification and sequencing of the reverse-transcribed total RNA obtained from the patients' lymphoblastoid or fibroblast cell lines. The mutations c.825+5G>C and c.770T>C resulted in varyable amounts of abnormal transcripts, r.822_825del (p.C275fsX2) and [r.770u>c, r.652_771del, r.613_771del (p.L257P, p.G218_L257del, p.I205_L257del)]. All mutations demonstrated low residual activities (0.1-1.3 %) when expressed in COS-1 cells confirming the causality of the mutations and the enzymatic defect of the disease. The clinical outcome, prognosis and correlation between the HMBS genotype and phenotype were studied in 143 Finnish and Russian AIP patients with ten mutations (c.33G>T, c.97delA, InsAlu333, p.R149X, p.R167W, p.R173W, p.R173Q, p.R225G, p.R225X, c.1073delA) and more than six patients in each group. The patients were selected from the pool of 287 Finnish AIP patients presented in a Finnish Porphyria Register (1966-2003) and 23 Russian AIP patients (diagnosed 1995-2003). Patients with the p.R167W and p.R225G mutations showed lower penetrance (19% and 11%) and the recurrence rate (33% and 0%) in comparison to the patients with other mutations (range 36 to 67% and 0 to 66%, respectively), as well as milder biochemical abnormalities [urinary porphobilinogen 47±10 vs. 163±21 mol/L, p<0.001; uroporphyrin 130±40 vs. 942±183 nmol/L, p<0.001] suggesting a milder form of AIP in these patients. Erythrocyte HMBS activity did not correlate with the porphobilinogen excretion in remission or the clinical of the disease. In all AIP severity patients, normal PBG excretion predicted freedom from acute attacks. Urinary PBG excretion together with gender, age at the time of diagnosis and mutation type could predict the likelihood of acute attacks in AIP patients.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fatigue fracture is an overuse injury commonly encountered in military and sports medicine, and known to relate to intensive or recently intensified physical activity. Bone responds to increased stress by enhanced remodeling. If physical stress exceeds bone s capability to remodel, accumulation of microfractures can lead to bone fatigue and stress fracture. Clinical diagnosis of stress fractures is complex and based on patient s anamnesis and radiological imaging. Bone stress fractures are mostly low-risk injuries, healing well after non-operative management, yet, occurring in high-risk areas, stress fractures can progress to displacement, often necessitating surgical treatment and resulting in prolonged morbidity. In the current study, the role of vitamin D as a predisposing factor for fatigue fractures was assessed using serum 25OHD level as the index. The average serum 25OHD concentration was significantly lower in conscripts with fatigue fracture than in controls. Evaluating TRACP-5b bone resorption marker as indicator of fatigue fractures, patients with elevated serum TRACP-5b levels had eight times higher probability of sustaining a stress fracture than controls. Among the 154 patients with exercise induced anterior lower leg pain and no previous findings on plain radiography, MRI revealed a total of 143 bone stress injuries in 86 patients. In 99% of the cases, injuries were in the tibia, 57% in the distal third of the tibial shaft. In patients with injury, forty-nine (57%) patients exhibited bilateral stress injuries. In a 20-year follow-up, the incidence of femoral neck fatigue fractures prior to the Finnish Defence Forces new regimen in 1986 addressing prevention of these fractures was 20.8/100,000, but rose to 53.2/100,000 afterwards, a significant 2.6-fold increase. In nineteen subjects with displaced femoral neck fatigue fractures, ten early local complications (in first postoperative year) were evident, and after the first postoperative year, osteonecrosis of the femoral head in six and osteoarthritis of the hip in thirteen patients were found. It seems likely that low vitamin D levels are related to fatigue fractures, and that an increasing trend exists between TRACP-5b bone resorption marker elevation and fatigue fracture incidence. Though seldom detected by plain radiography, fatigue fractures often underlie unclear lower leg stress-related pain occurring in the distal parts of the tibia. Femoral neck fatigue fractures, when displaced, lead to long-term morbidity in a high percentage of patients, whereas, when non-displaced, they do not predispose patients to subsequent adverse complications. Importantly, an educational intervention can diminish the incidence of fracture displacement by enhancing awareness and providing instructions for earlier diagnosis of fatigue fractures.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Drugs and surgical techniques may have harmful renal effects during the perioperative period. Traditional biomarkers are often insensitive to minor renal changes, but novel biomarkers may more accurately detect disturbances in glomerular and tubular function and integrity. The purpose of this study was first, to evaluate the renal effects of ketorolac and clonidine during inhalation anesthesia with sevoflurane and isoflurane, and secondly, to evaluate the effect of tobacco smoking on the production of inorganic fluoride (F-) following enflurane and sevoflurane anesthesia as well as to determine the effect of F- on renal function and cellular integrity in surgical patients. A total of 143 patients undergoing either conventional (n = 75) or endoscopic (n = 68) inpatient surgery were enrolled in four studies. The ketorolac and clonidine studies were prospective, randomized, placebo controlled and double-blinded, while the cigarette smoking studies were prospective cohort studies with two parallel groups. As a sign of proximal tubular deterioration, a similar transient increase in urine N-acetyl-beta-D-glucosaminidase/creatinine (U-NAG/crea) was noted in both the ketorolac group and in the controls (baseline vs. at two hours of anesthesia, p = 0.015) with a 3.3 minimum alveolar concentration hour sevoflurane anesthesia. Uncorrelated U-NAG increased above the maximum concentration measured from healthy volunteers (6.1 units/l) in 5/15 patients with ketorolac and in none of the controls (p = 0.042). As a sign of proximal tubular deterioration, U-glutathione transferase-alpha/crea (U-GST-alpha/crea) increased in both groups at two hours after anesthesia but a more significant increase was noted in the patients with ketorolac. U-GST-alpha/crea increased above the maximum ratio measured from healthy volunteers in 7/15 patients with ketorolac and in 3/15 controls. Clonidine diminished the activation of the renin-angiotensin aldosterone system during pneumoperitoneum; urine output was better preserved in the patients treated with clonidine (1/15 patients developed oliguria) than in the controls (8/15 developed oliguria (p=0.005)). Most patients with pneumoperitoneum and isoflurane anesthesia developed a transient proximal tubular deterioration, as U-NAG increased above 6.1 units/L in 11/15 patients with clonidine and in 7/15 controls. In the patients receiving clonidine treatment, the median of U-NAG/crea was higher than in the controls at 60 minutes of pneumoperitoneum (p = 0.01), suggesting that clonidine seems to worsen proximal tubular deterioration. Smoking induced the metabolism of enflurane, but the renal function remained intact in both the smokers and the non-smokers with enflurane anesthesia. On the contrary, smoking did not induce sevoflurane metabolism, but glomerular function decreased in 4/25 non-smokers and in 7/25 smokers with sevoflurane anesthesia. All five patients with S-F- ≥ 40 micromol/L, but only 6/45 with S-F- less than 40 micromol/L (p = 0.001), developed a S-tumor associated trypsin inhibitor concentration above 3 nmol/L as a sign of glomerular dysfunction. As a sign of proximal tubulus deterioration, U-beta 2-microglobulin increased in 2/5 patients with S-F- over 40 micromol/L compared to 2/45 patients with the highest S-F- less than 40 micromol/L (p = 0.005). To conclude, sevoflurane anesthesia may cause a transient proximal tubular deterioration which may be worsened by a co-administration of ketorolac. Clonidine premedication prevents the activation of the renin-angiotensin aldosterone system and preserves normal urine output, but may be harmful for proximal tubules during pneumoperitoneum. Smoking induces the metabolism of enflurane but not that of sevoflurane. Serum F- of 40 micromol/L or higher may induce glomerular dysfunction and proximal tubulus deterioration in patients with sevoflurane anesthesia. The novel renal biomarkers warrant further studies in order to establish reference values for surgical patients having inhalation anesthesia.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The keto-enol type tautomerism in anti-thyroid drugs and their selenium analogues are described. The commonly used anti-thyroid drug methimazole exists predominantly in its thione form, whereas its selenium analogue exists in a zwitterionic form. To understand the effect of thione/thiol and selone/selenol tautomerism on the inhibition of peroxidase-catalysed reactions, we have synthesized some thiones and selones in which the formation of thiol/selenol forms are blocked by different substituents. These compounds were synthesized by a carbene route utilizing an imidazolium salt. The crystal structures of these compounds reveal that the C=Se bonds in the selones are more polarized than the C=S bonds in the corresponding thiones. The structures of selones were studied in solution by NMR spectroscopy and the 77Se NMR chemical shifts for the selones show large upfield shifts in the signals, confirming their zwitterionic structures in solution. The inhibition of lactoperoxidase by the synthetic thiones indicates that the presence of a free N-H moiety is essential for an efficient inhibition. In contrast, such moiety is not required for an inhibition by the selenium compounds.