Tuning The Surface Anisotropy In Fe-doped Nio Nanoparticles.

Ni(1-x)FexO nanoparticles have been obtained by the co-precipitation chemical route. X-ray diffraction analyses using Rietveld refinement have shown a slight decrease in the microstrain and mean particle size as a function of the Fe content. The zero-field-cooling (ZFC) and field-cooling (FC) magnetization curves show superparamagnetic behavior at high temperatures and a low temperature peak (at T = 11 K), which is enhanced with increasing Fe concentration. Unusual behavior of the coercive field in the low temperature region and an exchange bias behavior were also observed. A decrease in the Fe concentration induces an increase in the exchange bias field. We argue that these behaviors can be linked with the strengthening of surface anisotropy caused by the incorporation of Fe ions.

Validity And Reliability Of A Pediatric Patient Classification Instrument.

to assess the construct validity and reliability of the Pediatric Patient Classification Instrument. correlation study developed at a teaching hospital. The classification involved 227 patients, using the pediatric patient classification instrument. The construct validity was assessed through the factor analysis approach and reliability through internal consistency. the Exploratory Factor Analysis identified three constructs with 67.5% of variance explanation and, in the reliability assessment, the following Cronbach's alpha coefficients were found: 0.92 for the instrument as a whole; 0.88 for the Patient domain; 0.81 for the Family domain; 0.44 for the Therapeutic procedures domain. the instrument evidenced its construct validity and reliability, and these analyses indicate the feasibility of the instrument. The validation of the Pediatric Patient Classification Instrument still represents a challenge, due to its relevance for a closer look at pediatric nursing care and management. Further research should be considered to explore its dimensionality and content validity.

Preserved Fertility In A Patient With Gynecomastia Associated With The P.pro695ser Mutation In The Androgen Receptor.

The androgen insensitivity syndrome (AIS) is described as a dysfunction of the androgen receptor (AR) in 46,XY individuals, which can be associated with mutations in the AR gene or can be due to unknown mechanisms. Different mutations in AIS generally cause variable phenotypes that range from a complete hormone resistance to a mild form usually associated with male infertility. The purpose of this study was to search for mutations in the AR gene in a fertile man with gynecomastia and to evaluate the influence of the mutation on the AR transactivation ability. Sequencing of the AR gene revealed the p.Pro695Ser mutation. It is located within the AR ligand-binding domain. Bioinformatics analysis indicated a deleterious role, which was verified after testing transactivation activity and N-/C-terminal (N/C) interaction by in vitro expression of a reporter gene and 2-hybrid assays. p.Pro695Ser showed low levels of both transactivation activity and N/C interaction at low dihydrotestosterone (DHT) conditions. As the ligand concentration increased, both transactivation activity and N/C interaction also increased and reached normal levels. Therefore, this study provides functional insights for the p.Pro695Ser mutation described here for the first time in a patient with mild AIS. The expression profile of p.Pro695Ser not only correlates to the patient's phenotype, but also suggests that a high-dose DHT therapy may overcome the functional deficit of the mutant AR.

Survival Extrapolation In The Presence Of Cause Specific Hazards.

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Patient With Numerous Papules And Spontaneous Pneumothorax.

71

[pediatric Patient Classification System: Improvement Of An Instrument].

Improve the content validity of the instrument for classification of pediatric patients and evaluate its construct validity. A descriptive exploratory study in the measurement of the content validity index, and correlational design for construct validation through exploratory factor analysis. The content validity index for indicators was 0.99 and it was 0.97 for graded situations. Three domains were extracted in the construct validation, namely: patient, family and therapeutic procedures, with 74.97% of explained variance. The instrument showed evidences of content and construct validity. The validation of the instrument occurred under the approach of family-centered care, and allowed incorporating some essential needs of childhood such as playing, interaction and affection in the content of the instrument.

The Ccr5Δ32 Polymorphism In Brazilian Patients With Sickle Cell Disease.

Previous studies on the role of inflammation in the pathophysiology of sickle cell disease (SCD) suggested that the CCR5Δ32 allele, which is responsible for the production of truncated C-C chemokine receptor type 5 (CCR5), could confer a selective advantage on patients with SCD because it leads to a less efficient Th1 response. We determined the frequency of the CCR5Δ32 polymorphism in 795 Afro-Brazilian SCD patients followed up at the Pernambuco Hematology and Hemotherapy Center, in Northeastern Brazil, divided into a pediatric group (3 months-17 years, n = 483) and an adult group (18-70 years, n = 312). The adult patients were also compared to a healthy control group (blood donors, 18-61 years, n = 247). The CCR5/CCR5Δ32 polymorphism was determined by allele-specific PCR. No homozygous patient for the CCR5Δ32 allele was detected. The frequency of heterozygotes in the study population (patients and controls) was 5.8%, in the total SCD patients 5.1%, in the children 5.4%, in the adults with SCD 4.8%, and in the adult controls 8.1%. These differences did not reach statistical significance. Our findings failed to demonstrate an important role of the CCR5Δ32 allele in the population sample studied here.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

[consensus Of The Brazilian Society Of Rheumatology For The Diagnosis, Management And Treatment Of Lupus Nephritis].

To develop recommendations for the diagnosis, management and treatment of lupus nephritis in Brazil. Extensive literature review with a selection of papers based on the strength of scientific evidence and opinion of the Commission on Systemic Lupus Erythematosus members, Brazilian Society of Rheumatology. 1) Renal biopsy should be performed whenever possible and if this procedure is indicated; and, when the procedure is not possible, the treatment should be guided with the inference of histologic class. 2) Ideally, measures and precautions should be implemented before starting treatment, with emphasis on attention to the risk of infection. 3) Risks and benefits of treatment should be shared with the patient and his/her family. 4) The use of hydroxychloroquine (preferably) or chloroquine diphosphate is recommended for all patients (unless contraindicated) during induction and maintenance phases. 5) The evaluation of the effectiveness of treatment should be made with objective criteria of response (complete remission/partial remission/refractoriness). 6) ACE inhibitors and/or ARBs are recommended as antiproteinuric agents for all patients (unless contraindicated). 7) The identification of clinical and/or laboratory signs suggestive of proliferative or membranous glomerulonephritis should indicate an immediate implementation of specific therapy, including steroids and an immunosuppressive agent, even though histological confirmation is not possible. 8) Immunosuppressives must be used during at least 36 months, but these medications can be kept for longer periods. Its discontinuation should only be done when the patient achieve and maintain a sustained and complete remission. 9) Lupus nephritis should be considered as refractory when a full or partial remission is not achieved after 12 months of an appropriate treatment, when a new renal biopsy should be considered to assist in identifying the cause of refractoriness and in the therapeutic decision.

Synchronous Oral Paracoccidioidomycosis And Pulmonary Tuberculosis In An Immunocompetent Patient.

Paracoccidioidomycosis (PCM) and tuberculosis (TB) are chronic granulomatous infectious diseases, in which the main form of contraction is through inhalation of the microorganism-Paracoccidioides brasiliensis and Mycobacterium tuberculosis. Oral involvement of PCM is observed in up to 70 % of the cases and usually presents clinically as ulcerations with granular surface showing tiny hemorrhagic areas. Oral presentation of TB is rare with prevalence smaller than 0.5 % of all cases. Clinical presentation of oral TB mainly consists of single ulcers with irregular limits and necrotic base. A 70-year-old immunocompetent man presented simultaneously oral PCM and pulmonary TB. Medical history revealed a previous diagnosis of pulmonary TB; however, even under treatment for TB, the patient remained with oral lesions and intense pulmonary fibrosis. The physician requested P. brasiliensis serological analysis, which resulted positive. Although the combination of PCM and TB has been reported in the literature, it is still considered an uncommon condition and their diagnosis may represent a challenge to healthcare professionals because of the similarity between their clinical and radiological presentations.

Preclinical Target Validation Using Patient-derived Cells.

The Structural Genomics Consortium (SGC) and its clinical, industry and disease-foundation partners are launching open-source preclinical translational medicine studies.

Synthesis, characterization, DFT and Td-dfT study of the [Fe(mnt)(L)(t-BuNC) 2] octahedral complex (L = phen, bipy)

FeBr2 has reacted with an equivalent of mnt2- (mnt = cis-1,2-dicyanoethylene-1,2-dithiolate) and the α-diimine L (L = 1,10'-phenantroline, 2,2'-bipyridine) in THF solution, and followed by adding of t-butyl-isocyanide to give [Fe(mnt)(L)(t-BuNC)2] neutral compound. The products were characterized by infrared, UV-visible and Mössbauer spectroscopy, besides thermogravimetric and conductivity data. The geometry in the equilibrium was calculated by the density functional theory and the electronic spectrum by the time-dependent. The experimental and theoretical results in good agreement have defined an octahedral geometry with two isocyanide neighbours. The π→π* intraligand electronic transition was not observed for cis-isomers in the near-IR spectral region.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Novel DMRT1 3'UTR+11insT mutation associated to XY partial gonadal dysgenesis

The Y-chromosome-located SRY gene encodes a small testis-specific protein containing a DNA-binding motif known as the HMG (high mobility group) box. However, mutations in SRY are not frequent especially in cases of 46,XY partial gonadal dysgenesis. Several sex-determining genes direct the fate of the bipotential gonad to either testis or ovary. In addition, heterozygous small deletions in 9p can cause complete and partial XY gonadal dysgenesis without other symptoms. Human DMRT1 gene, which is located at 9p24.3, is expressed in testis and ovary and has been considered, among others, a candidate autosomal gene responsible for gonadal dysgenesis. In this report we describe a nucleotide insertion in DMRT1 3'UTR in a patient of XY partial gonadal dygenesis. The 3'UTR+11insT is located within a conserved motif important for mRNA stabilization.

Structural aspects of the p.P222Q homozygous mutation of HSD3B2 gene in a patient with congenital adrenal hyperplasia

Type II 3β-hydroxysteroid dehydrogenase/Δ5-Δ4-isomerase (3β-HSD2), encoded by the HSD3B2 gene, is a key enzyme involved in the biosynthesis of all the classes of steroid hormones. Deleterious mutations in the HSD3B2 gene cause the classical deficiency of 3β-HSD2, which is a rare autosomal recessive disease that leads to congenital adrenal hyperplasia (CAH). CAH is the most frequent cause of ambiguous genitalia and adrenal insufficiency in newborn infants with variable degrees of salt losing. Here we report the molecular and structural analysis of the HSD3B2 gene in a 46,XY child, who was born from consanguineous parents, and presented with ambiguous genitalia and salt losing. The patient carries a homozygous nucleotide c.665C>A change in exon 4 that putatively substitutes the proline at codon 222 for glutamine. Molecular homology modeling of normal and mutant 3β-HSD2 enzymes emphasizes codon 222 as an important residue for the folding pattern of the enzyme and validates a suitable model for analysis of new mutations.