Avaliação de linhas de beneficiamento e impactos de queda na qualidade de caqui Rama Forte

Excessive and inadequate handling of fruits and vegetables provides high incidences of physical damage, consequently, post harvest losses. The main goal of this work was to evaluate the impact magnitude in persimmon packing lines, Rama Forte, and to determine, at the laboratory, its impact limits. For evaluating the critical points it was used an instrumented sphere of 76 mm of diameter (Technmark, Inc, Lansing, USA), which registered the impact magnitude in seven distinctive impact lines located in four packing houses. For determining physical damages, tests were carried out at the laboratory, where fruit drop was related to impact magnitude, physical damage incidence and fruit post harvest losses. At the packing lines, the values found varied from 21 to 87 G on the transfer points and the majority of registered impacts (over 94%) were down 50G. Drops from 20 cm caused an increase in weight losses after six days of storage at room temperature. Drops from 20 and 30 cm caused skin darkness (low L values), associated to a decrease in color intensity (chroma). Impact drop did not affect pulp fruit chemical features.

Lianas da estação ecológica do Noroeste Paulista, São José do Rio Preto/Mirassol, SP, Brasil

Lianas are characteristic, abundant and ecologically important members of tropical forest but they have been neglected in floristics and phytossociological studies. This work presents a floristic survey of the lianas species at Estação Ecológica do Noroeste Paulista (EENP), and a comparison of the list of species recorded in this work with those reported for other fragments of São Paulo state. The EENP (20º48'36'' S and 49º22'50'' W) is at 468 m of altitude and comprises an area of 168,43 ha, divided into three fragments of vegetation. Samples of lianas were collected in the interior and along the edges of the forest fragments. It was identified 105 species: 99 Magnoliopsida (60 genera and 22 families); six Liliopsida (three genera and three families). The richest families in species comprised 59% of the total of lianas sampled. The dendrogram of similarity showed a low similarity between the forest situated in the littoral (Atlantic Forest) and those located in the interior of the state of São Paulo. Some other authors, also analysing the similarity of forest of the interior and Atlantic Forest of São Paulo state, but considering only the trees reported similar result.

Projeto de caixa de madeira para manga (Mangifera Indica L.)

Losses of horticulture product in Brazil are significant and among the main causes are the use of inappropriate boxes and the absence of a cold chain. A project for boxes is proposed, based on computer simulations, optimization and experimental validation, trying to minimize the amount of wood associated with structural and ergonomic aspects and the effective area of the openings. Three box prototypes were designed and built using straight laths with different configurations and areas of openings (54% and 36%). The cooling efficiency of Tommy Atkins mango (Mangifera Indica L.) was evaluated by determining the cooling time for fruit packed in the wood models and packed in the commercially used cardboard boxes, submitted to cooling in a forced-air system, at a temperature of 6ºC and average relative humidity of 85.4±2.1%. The Finite Element Method was applied, for the dimensioning and structural optimization of the model with the best behavior in relation to cooling. All wooden boxes with fruit underwent vibration testing for two hours (20 Hz). There was no significant difference in average cooling time in the wooden boxes (36.08±1.44 min); however, the difference was significant in comparison to the cardboard boxes (82.63±29.64 min). In the model chosen for structural optimization (36% effective area of openings and two side laths), the reduction in total volume of material was 60% and 83% in the cross section of the columns. There was no indication of mechanical damage in the fruit after undergoing the vibration test. Computer simulations and structural study may be used as a support tool for developing projects for boxes, with geometric, ergonomic and thermal criteria.

Qualidade pós-colheita de caqui 'fuyu' com utilização de diferentes concentrações de cobertura comestível

One of the main objectives of applying edible coatings on fruits surface is to create a protective film to reduce weight loss due to evaporation and transpiration and also to decrease the risk of fruit rot caused by environmental contamination, in order to improve the visual aspect. Therefore, it is possible to increase shelf life, and decrease post harvest losses. Persimmon is a much appreciated fruit, with high potential for export, but sensitive to handling and storage. This study aimed to evaluate the effect of applying the edible coating Megh Wax ECF-124 (18% of active composts, consisting of emulsion of carnauba wax, anionic surfactant, preservative and water) produced by Megh Industry and Commerce Ltda in three different concentrations (25, 50 and 100%) on post harvest quality of 'Fuyu' persimmon stored for 14 days. The attributes evaluated for quality were: firmness, pH, acidity, soluble solids, weight loss and color. The results showed that application of carnauba wax in different concentrations was effective on decreasing weight loss of persimmon cv. Fuyu and maintenance of color aspects. Treatment at lower concentration, 25%, showed lower rate of discharge, but high concentrations showed lower values of mass loss. Carnauba wax application showed a high potential for use on postharvest conservation, and can be applied together with other technologies, helping to maintain quality for export.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Efeitos da atividade fisica sobre o sistema locomotor e nos habitos de vida

Universidade Estadual de Campinas. Faculdade de Educação Física

Isolation and characterization of Flavobacterium columnare (Bernardet et al. 2002) from four tropical fish species in Brazil

Flavobacterium columnare is the causative agent of columnaris disease in freshwater fish, implicated in skin and gill disease, often causing high mortality. The aim of this study was the isolation and characterization of Flavobacterium columnare in tropical fish in Brazil. Piracanjuba (Brycon orbignyanus), pacu (Piaractus mesopotamicus), tambaqui (Colossoma macropomum) and cascudo (Hypostomus plecostomus) were examined for external lesions showing signs of colunmaris disease such as greyish white spots, especially on the head, dorsal part and caudal fin of the fish. The sampling comprised 50 samples representing four different fish species selected for study. Samples for culture were obtained by skin and kidney scrapes with a sterile cotton swabs of columnaris disease fish and streaked onto Carlson and Pacha (1968) artificial culture medium (broth and solid) which were used for isolation. The strains in the liquid medium were Gram negative, long, filamentous, exhibited flexing movements (gliding motility), contained a large number of long slender bacteria and gathered into ‘columns'. Strains on the agar produced yellow-pale colonies, rather small, flat that had rhizoid edges. A total of four Flavobacterium columnare were isolated: 01 Brycon orbignyanus strain, 01 Piaractus mesopotamicus strain, 01 Colossoma macropomum strain, and 01 Hypostomus plecostomus strain. Biochemical characterization, with its absorption of Congo red dye, production of flexirubin-type pigments, H2S production and reduction of nitrates proved that the isolate could be classified as Flavobacterium columnare.

Integração vertical como estratégia de apropriação de valor: um estudo exploratório no canal de distribuição de produtos agrícolas

Neste artigo, investiga-se a adoção de canais alternativos para a comercialização de produtos agrícolas como forma de atenuar o poder, cada vez maior, exercido pelas grandes redes varejistas. O artigo investiga a decisão - e os efeitos daí decorrentes - de uma determinada empresa sediada no interior paulista, agrícola Pedra Branca, quanto à operacionalização verticalizada de uma butique de frutas, legumes e verduras (FLVs). Consciente dos novos padrões demandados pelo consumidor, a estratégia da empresa alvo do estudo foi combinar a oferta regular de produtos frescos, de qualidade intrínseca padronizada e preços atrativos, a um serviço diferenciado, baseado em um alto valor na experiência de compra. Esta estratégia fundamenta-se no anseio dos consumidores de, mais do que simplesmente adquirir produtos, experimentar sensações, as quais vividas em momentos de lazer exerceriam um grande poder de diferenciação. Realizou-se um estudo de caso baseado em entrevistas em profundidade semiestruturadas com diretores e gerentes da empresa. Como resultado, as evidências empíricas sugerem: 1) a verticalização (integração vertical) da atividade de comercialização como uma alternativa para a apropriação de valor da produção ao longo do canal de distribuição; e 2) o desafio da gestão do suprimento como requisito-chave para a adequada gestão do valor de uma marca. Considera-se oportuno lembrar, porém, que, em decorrência das limitações próprias da metodologia de estudos de caso, estas tais evidências devem ser entendidas como proposição a ser testada em trabalhos quantitativos futuros, ou mesmo melhor embasada via condução de estudos multicaso.

Desidratação e recomendações para a reposição hídrica em crianças fisicamente ativas

OBJETIVO: A prática de exercícios físicos, devido à produção inerente de calor, pode conduzir à desidratação. A maioria dos estudos que abordam os riscos da desidratação e fornecem recomendações de reposição hídrica é direcionada a indivíduos adultos residentes em regiões de clima temperado, porém, em regiões tropicais, pouco é conhecido sobre as necessidades de reposição hídrica em crianças fisicamente ativas. Esta revisão discute as recomendações para esta população e estabelece os riscos da prática esportiva em ambiente de clima tropical. FONTES DE DADOS: Análise sistemática com levantamento da literatura nacional (SciELO) e internacional (Medline) de artigos publicados entre 1972 e 2009, com os seguintes descritores isolados ou em combinação: hidratação, crianças, desidratação e reposição hídrica. Foram selecionados artigos publicados nas línguas portuguesa e inglesa. SÍNTESES DE DADOS: Observou-se que há riscos de desidratação e possível desenvolvimento de um quadro de hipertermia principalmente se as crianças são submetidas a condições climáticas desfavoráveis sem reposição hídrica adequada. O principal fator desencadeante da hipertermia é a menor adaptação das crianças aos extremos de temperatura, em comparação aos adultos, por possuírem área maior de superfície corporal e capacidade menor de termorregulação por evaporação. CONCLUSÕES: Conhecidos os fatores intervenientes da desidratação, a melhor recomendação, perante uma condição climática sabidamente desfavorável, é estabelecer um plano impositivo de hidratação com bebida com sabor e acréscimo de carboidratos e sódio, evitando-se uma perda hídrica significativa, diminuição da performance e, principalmente, com o objetivo de reduzir os riscos à saúde impostos pela hipertermia e desidratação a crianças fisicamente ativas.

Hydrometeor and latent heat profiles of tropical cyclones Conson, Ivan and Catarina using PR/TRMM data

ABSTRACT Microphysical and thermodynamical features of two tropical systems, namely Hurricane Ivan and Typhoon Conson, and one sub-tropical, Catarina, have been analyzed based on space-born radar PR measurements available on the TRMM satellite. The procedure to classify the reflectivity profiles followed the Heymsfield et al (2000) and Steiner et al (1995) methodologies. The water and ice content have been calculated using a relationship obtained with data of the surface SPOL radar and PR in Rondonia State in Brazil. The diabatic heating rate due to latent heat release has been estimated using the methodology developed by Tao et al (1990). A more detailed analysis has been performed for Hurricane Catarina, the first of its kind in South Atlantic. High water content mean value has been found in Conson and Ivan at low levels and close to their centers. Results indicate that hurricane Catarina was shallower than the other two systems, with less water and the water was concentrated closer to its center. The mean ice content in Catarina was about 0.05 g kg-1 while in Conson it was 0.06 g kg-1 and in Ivan 0.08 g kg-1. Conson and Ivan had water content up to 0.3 g kg-1 above the 0ºC layer, while Catarina had less than 0.15 g kg-1. The latent heat released by Catarina showed to be very similar to the other two systems, except in the regions closer to the center.

Fire management and the nesting of Athene cunicularia (Aves, Strigidae) in grasslands in central Cerrado, Brazil

Fire management is a common practice in several reserves in the Cerrado, but its influences on bird reproduction remain unknown. In addition, the nesting biology of the Burrowing Owl (Athene cunicularia) has been studied in numerous environments, but not in tropical grasslands managed by fire. This study examined the effects of fire management on the nesting biology of A. cunicularia in Emas National Park, State of Goias, central Brazilian Cerrado. We compared the number of breeding pairs and their burrows in October and November 2009 at 15 study sites in grasslands managed by fire (firebreaks) and unmanaged grasslands adjacent to and distant from firebreaks. We visited active burrows two-four times and described the burrow entrances and sentinel sites and counted and observed adults and young. A total of 19 burrows were found at firebreaks. One and two burrows were found in grasslands adjacent to and distant from firebreaks, respectively. For all burrows found, one to three young reached the adult size, being able to fly and/or run in early November. The 22 burrows found were in the ground, associated or not with termite and ant nests. Most (86.4%) burrows had only one entrance. Only three burrows had two or three entrances. Structures used as sentinel perches by adults were mounds in front of the burrow entrances, termite nests, shrubs and trees. Most of these sentinel sites were shorter than 2 m high and located less than 10 m from the burrow entrance. At Emas National Park, firebreaks appear to provide more attractive conditions to the nesting of A. cunicularia than unmanaged grasslands, likely because of the short herbaceous stratum due to frequent burning of firebreaks. This study suggests that fire management provides suitable conditions for the successful reproduction of A. cunicularia in firebreaks at Emas National Park.

Seasonal variation of soluble carbohydrates and starch in Echinolaena inflexa, a native grass species from the Brazilian savanna, and in the invasive grass Melinis minutiflora

Echinolaena inflexa (Poir.) Chase is an abundant C3 grass species with high biomass production in the Brazilian savanna (cerrado); Melinis minutiflora Beauv. is an African C4 forage grass widespread in cerrado and probably displacing some native herbaceous species. In the present work, we analysed seasonally the content and composition of soluble carbohydrates, the starch amounts and the above-ground biomass (phytomass) of E. inflexa and M. minutiflora plants harvested in two transects at 5 and 130 m from the border in a restrict area of cerrado at the Biological Reserve and Experimental Station of Mogi-Guaçu (SP, Brazil). Results showed that water soluble carbohydrates and starch amounts from the shoots of both species varied according to the time of the year, whilst in the underground organs, variations were observed mainly in relation to the transects. Marked differences in the pattern of the above-ground biomass production between these two grasses relative to their location in the Reserve were also observed, with two peaks of the invasive species (July and January) at the Reserve border. The differences in carbohydrate accumulation, partitioning and composition of individual sugars concerning time of the year and location in the Reserve were more related to the annual growth cycle of both grasses and possibly to specific physiological responses of M. minutiflora to disturbed environments in the Reserve border.

Ant community richness and composition across a gradient from Eucalyptus plantations to secondary Atlantic Forest

Secondary forests and exotic tree plantations are expanding across tropical landscapes. However, our current understanding of the value of these human-dominated forest landscapes for invertebrate biodiversity conservation is still very poor. In this paper, we use the leaf-litter ant fauna to assess invertebrate diversity in one commercially managed Eucalyptus plantation (four years old), two abandoned plantations of different regeneration ages (16 and 31 years), and one neighboring secondary Atlantic Forest in Southeastern Brazil. There was a clear gradient in species richness from the secondary forest to the managed Eucalyptus plantation; richness and diversity peaked in secondary forest and in the older regenerating Eucalyptus plantation. Significantly more species were recorded in secondary forest samples than in Eucalyptus plantations, but Eucalyptus plantations had a similar level of richness. Furthermore, a non-metric multidimensional scaling analysis revealed clear differences in species composition between the younger managed Eucalyptus plantation (understory absent) and habitats with sub-developed or developed understory. Eucalyptus plantations were characterized by an assemblage of widespread, generalist species very different from those known to occur in core forest habitats of southeastern Brazil. Our results indicate that while older regenerating Eucalyptus plantations can provide habitat to facilitate the persistence of generalist ant species, it is unlikely to conserve most of the primary forest species, such as specialized predators, Dacetini predators, and nomadic species.

Stability of fruit bases and chocolate fillings

Syrups with high sugar content and dehydrated fruits in its composition can be added to chocolate fillings to reduce the need of artificial flavor and dyes attributing a natural appeal to the product. Fruit bases were produced with lyophilized strawberry, passion fruit, and sliced orange peel. Rheological dynamic oscillatory tests were applied to determine the products stability and tendency of shelf life. Values of G´< G´´ were observed for strawberry and passion fruit flavor, whereas values of G´ > G´´ were found for orange flavor during the 90 days of storage. It was observed that shear stress values did not vary significantly suggesting product stability during the studied period. For all fillings, it was found a behavior similar to the fruit base indicating that it has great influence on the filling behavior and its stability. The use of a sugar matrix in fillings provided good shelf life for the fruit base, which could be kept under room temperature conditions for a period as long as one year. The good stability and storage conditions allow the use of fruit base for handmade products as well as for industrialized products.

Spatial and temporal distribution of fish in Palmas bay, Ubatuba, Brazil

The aim of this study was to analyze the distribution and abundance of the fish fauna of Palmas bay on Anchieta Island in southeastern Brazil. Specimens were caught in the summer and winter of 1992, using an otter trawl at three locations in the bay. The specimens were caught in both the nighttime and daytime. Data on the water temperature and salinity were recorded for the characterization of the predominant water mass in the region, and sediment samples were taken for granulometric analysis. A total of 7 656 specimens (79 species), with a total weight of approximately 300 kg, were recorded. The most abundant species were Eucinostomus argenteus, Ctenosciaena gracilicirrhus, Haemulon steindachneri, Eucinostomus gula and Diapterus rhombeus, which together accounted for more than 73% of the sample. In general, the ecological indices showed no differences in the composition of species for the abiotic variables analyzed. The multivariate analysis showed that the variations in the distribution of the fish fauna were mainly associated with intra-annual differences in temperature and salinity, resulting from the presence of South Atlantic Central Water (SACW) in the area during the summer. The analysis also showed an association with the type of bottom and a lesser association with respect to the night/day periods.