Characterization Of Anfo Explosive By High Accuracy Esi(±)-ftms With Forensic Identification On Real Samples By Easi(-)-ms.

Ammonium nitrate fuel oil (ANFO) is an explosive used in many civil applications. In Brazil, ANFO has unfortunately also been used in criminal attacks, mainly in automated teller machine (ATM) explosions. In this paper, we describe a detailed characterization of the ANFO composition and its two main constituents (diesel and a nitrate explosive) using high resolution and accuracy mass spectrometry performed on an FT-ICR-mass spectrometer with electrospray ionization (ESI(±)-FTMS) in both the positive and negative ion modes. Via ESI(-)-MS, an ion marker for ANFO was characterized. Using a direct and simple ambient desorption/ionization technique, i.e., easy ambient sonic-spray ionization mass spectrometry (EASI-MS), in a simpler, lower accuracy but robust single quadrupole mass spectrometer, the ANFO ion marker was directly detected from the surface of banknotes collected from ATM explosion theft.

Pharmacological Characterization Of The Relaxation Induced By The Soluble Guanylate Cyclase Activator, Bay 60-2770 In Rabbit Corpus Cavernosum.

To characterize the relaxation induced by the soluble guanylate cyclase (sGC) activator, BAY 60-2770 in rabbit corpus cavernosum. Penis from male New Zealand rabbits were removed and fours strips of corpus cavernosum (CC) were obtained. Concentration-response curves to BAY 60-2770 were carried out in the absence and presence of inhibitors of nitric oxide synthase, L-NAME (100 μM), sGC, ODQ (10 μM) and phosphodiestarase type 5, tadalafil (0.1 μM). The potency (pEC50) and maximal response (Emax) values were determined. Second, electrical-field stimulation (EFS)-induced contraction or relaxation was realized in the absence and presence of BAY 60-2770 (0.1 or 1 μM) alone or in combination of ODQ (10 μM). In the case of EFS-induced relaxation two protocols were realized: 1) ODQ (10 μM) was first incubated for 20 min and then BAY 60-2770 (1 μM) was added for another 20 min (ODQ + BAY 60-2770). In different CC strips, BAY 60-2770 was incubated for 20 min followed by another 20 min with ODQ (BAY 60-2770 + ODQ). The intracellular levels of cyclic guanosine monophosphate (cGMP) were also determined. BAY 60-2770 potently relaxed rabbit CC with pEC50 and Emax values of 7.58 ± 0.19 and 81 ± 4%, respectively. The inhibitors ODQ (n=7) or tadalafil (n=7) produced 4.2- and 6.3-leftward shifts, respectively in BAY 60-2770-induced relaxation without interfering on the Emax values. The intracellular levels of cGMP were augmented after stimulation with BAY 60-2770 (1 μM) alone, whereas its co-incubation with ODQ produced even higher levels of cGMP. The EFS-induced contraction was reduced in the presence of BAY 60-2770 (1 μM) and this inhibition was even greater when BAY 60-2770 was co-incubated with ODQ. The nitrergic stimulation induced CC relaxation, which was abolished in the presence of ODQ. BAY 60-2770 alone increased the amplitude of relaxation. Co-incubation of ODQ and BAY 60-2770 did not alter the relaxation in comparison with ODQ alone. Interestingly, when BAY 60-2770 was incubated prior to ODQ, EFS-induced relaxation was partly restored in comparison with ODQ alone or ODQ + BAY 60-2770. Considering that the relaxation induced by the sGC activator, BAY 60-2770 was increased after sGC oxidation and unaltered in the absence of nitric oxide, these class of substances are advantageous over sGC stimulators or PDE5 inhibitors for the treatment in those patients with erectile dysfunction and high endothelial damage. This article is protected by copyright. All rights reserved.

Characterization Of A Protein-protein Interaction Network Of The Cbl-interacting Protein Kinase 8 From Sugarcane.

Plants are sessile organisms and have evolved to tolerate a constantly changing environment. After the onset of different stress conditions, calcineurin B-like (CBL) proteins can sense calcium signals and activate CBL-interacting protein kinase (CIPK) proteins, which can phosphorylate downstream proteins to reestablish plant homeostasis. Previous studies in the bioenergy crop sugarcane showed that the ScCIPK8 gene is induced by drought stress and is also related to sucrose content. Here, we have characterized the protein-protein interactions of ScCIPK8 with six CBL proteins (ScCBL1, ScCBL2, ScCBL3, ScCBL6, ScCBL9, and ScCBL10). Yeast two-hybrid assays showed that ScCIPK8 interacts with ScCBL1, ScCBL3, and ScCBL6. Bimolecular fluorescence complementation assays confirmed in planta the interactions that were observed in yeast cells. These findings give insights on the regulatory networks related to sugar accumulation and drought stress responses in sugarcane.

Biochemical And Morphological Alterations In The Achilles Tendon Of Mdx Mice.

Dystrophin-deficient muscles have repeated cycles of necrosis and regeneration, being susceptible to injury induced by muscle contractions. Some studies have demonstrated that tendons are also affected in mdx mice, based especially on the changes in biomechanical properties arising from the respective linked muscles. However, most studies have focused only on alterations in the myotendinous junction. Thus, the purpose of this work was to study biochemical and morphological alterations in the Achilles tendons of 60-day-old mdx mice. Hydroxyproline quantification, showed higher collagen concentration in the mdx mice as compared with the control. No difference between the tendons of both groups was found in the noncollagenous proteins dosage, and in the amount of collagen type III detected in the western blotting analysis. The zymography for gelatinases detection showed higher amounts of metaloproteinase-2 (active isoform) and of metalloproteinase-9 (latent isoform) in the mdx mice. Measurements of birefringence, using polarization microscopy, showed higher molecular organization of the collagen fibers in the tendons of mdx mice in comparison to the control group, with presence of larger areas of crimp. Ponceau SS-stained tendon sections showed stronger staining of the extracellular matrix in the mdx groups. Toluidine blue-stained sections showed more intense basophilia in tendons of the control group. In morphometry, a higher number of inflammatory cells was detected in the epitendon of mdx group. In conclusion, the Achilles tendon of 60-day-old mdx mice presents higher collagen concentration and organization of the collagen fibers, enhanced metalloproteinase-2 activity, as well as prominent presence of inflammatory cells and lesser proteoglycans.

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Extraction, purification and biochemical characterization of a peroxidase from Copaifera langsdorffii leaves

The aim of this work is to obtain, purify and characterize biochemically a peroxidase from Copaifera langsdorffii leaves (COP). COP was obtained by acetone precipitation followed by ion-exchange chromatography. Purification yielded 3.5% of peroxidase with the purification factor of 46.86. The COP optimum pH is 6.0 and the temperature is 35 ºC. COP was stable in the pH range of 4.5 to 9.3 and at temperatures below 50.0 ºC. The apparent Michaelis-Menten constants (Km) for guaiacol and H2O2 were 0.04 mM and 0.39 mM respectively. Enzyme turnover was 0.075 s-1 for guaiacol and 0.28 s-1 for hydrogen peroxide. Copaifera langsdorffii leaves showed to be a rich source of active peroxidase (COP) during the whole year. COP could replace HRP, the most used peroxidase, in analytical determinations and treatment of industrial effluents at low cost.

Synthesis, characterization, DFT and Td-dfT study of the [Fe(mnt)(L)(t-BuNC) 2] octahedral complex (L = phen, bipy)

FeBr2 has reacted with an equivalent of mnt2- (mnt = cis-1,2-dicyanoethylene-1,2-dithiolate) and the α-diimine L (L = 1,10'-phenantroline, 2,2'-bipyridine) in THF solution, and followed by adding of t-butyl-isocyanide to give [Fe(mnt)(L)(t-BuNC)2] neutral compound. The products were characterized by infrared, UV-visible and Mössbauer spectroscopy, besides thermogravimetric and conductivity data. The geometry in the equilibrium was calculated by the density functional theory and the electronic spectrum by the time-dependent. The experimental and theoretical results in good agreement have defined an octahedral geometry with two isocyanide neighbours. The π→π* intraligand electronic transition was not observed for cis-isomers in the near-IR spectral region.

Caracterização de dois equipamentos de beneficiamento e classificação de tomates para mesa

On the last years, in Brazil, sorting and classifying fruits and vegetables using packing lines have increased. This work aimed at characterizing the cleaning process for fresh market tomatoes at two packing lines, one imported and one national located at Campinas, São Paulo State. Characterization included data, number, types and brushes velocity, water use, fruit standing time and cleaning efficiency. Standing time was measured correlating to fruit diameter (CEAGESP). For measuring cleaning efficiency an equipment was developed that was mainly composed of a ring involved with white cloth. Samples were taken before and after the cleaning step and evaluated using a colorimeter HUNTER Lab. The results showed a strong difference between the two equipments. The imported equipment showed lower number on brushes and rotation than national one, however a higher water consumption. For imported equipments this relation was not found. Both packing lines showed the same cleaning efficiency. Cleaning efficiency is related to be an interaction among the studies parameters, and it could be necessary a better management than the one used on both equipments.

Caracterização morfoanatômica e histoquímica de Cuphea carthagenensis (Jacq.) J.f. Macbr. (Lythraceae)

Cuphea carthagenensis (Jacq.) J.F. Macbr. is an herb, which occurs preferably in wet places. Amongst other species of the genus, C. carthagenensis is distinguished for its great chemical potential and frequent use in popular medicine. In this study the morphological and anatomical structures were identified, as well as the histochemical characterization was done. Samples of root, stem and leaves were collected from adult plants. This material was processed for anatomical and histochemical analysis in light microscopy and for morphological analysis, in scanning electron microscopy. Important morphological and anatomical considerations were added for C. carthagenensis, such as: the occurrence of aerenchymatous phellem with suberized layers; the types of trichomes present in the vegetative organs, the characterization of secretory trichomes, as well as the secreted substances. The groups of secondary metabolites presents in the root, stem and leaf of C. carthagenensis with more intense histochemical reaction were: proanthocyanidins, phenolic compounds, acids polysaccharides (mucilage especially) and lipids.

A evolução da noção de parâmetros

This paper presents an overview of the concept of parameter in the Principles and Parameters theory, showing that a) in the first stage parameters were conceived as variation associated to the Principles and b) in the second stage as properties of the lexicon, and more specifically as properties of functional categories. The latter view has also developed from a substantive conception of functional categories to a more formal abstract characterization of functional heads. The paper also discusses parameters related to different levels of representation.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Paramentros fisiologicos, motores e morfologicos de bailarinas classicas

Universidade Estadual de Campinas . Faculdade de Educação Física

Physicochemical characterization of two deproteinized bovine xenografts

Calcium phosphate salts, or more specifically hydroxyapatite, are products of great interest in the fields of medical and dental science due to their biocompatibility and osteoconduction property. Deproteinized xenografts are primarily constituted of natural apatites, sintered or not. Variations in the industrial process may affect physicochemical properties and, therefore, the biological outcome. The purpose of this work was to characterize the physical and chemical properties of deproteinized xenogenic biomaterials, Bio-Oss (Geistlich Biomaterials, Wolhuser, Switzerland) and Gen-Ox (Baumer S.A., Brazil), widely used as bone grafts. Scanning electron microscopy, infrared region spectroscopy, X-ray diffraction, thermogravimetry and degradation analysis were conducted. The results show that both materials presented porous granules, composed of crystalline hydroxyapatite without apparent presence of other phases. Bio-Oss presented greater dissolution in Tris-HCl than Gen-Ox in the degradation test, possibly due to the low crystallinity and the presence of organic residues. In conclusion, both commercial materials are hydroxyapatite compounds, Bio-Oss being less crystalline than Gen-Ox and, therefore, more prone to degradation.

Morphological analysis of glass, carbon and glass/carbon fiber posts and bonding to self or dual-cured resin luting agents

OBJECTIVE: The aim of this study was to evaluate the morphology of glass (GF), carbon (CF) and glass/carbon (G/CF) fiber posts and their bond strength to self or dual-cured resin luting agents. MATERIAL AND METHODS: Morphological analysis of each post type was conducted under scanning electron microscopy (SEM). Bond strength was evaluated by microtensile test after bisecting the posts and re-bonding the two halves with the luting agents. Data were subjected to two-way ANOVA and Tukey's test (α=0.05). Failure modes were evaluated under optical microscopy and SEM. RESULTS: GF presented wider fibers and higher amount of matrix than CF, and G/CF presented carbon fibers surrounded by glass fibers, and both involved by matrix. For CF and GF, the dual-cured material presented significantly higher (p<0.05) bond strength than the self-cured agent. For the dual agent, CF presented similar bond strength to GF (p>0.05), but higher than that of G/CF (p<0.05). For the self-cured agent, no significant differences (p>0.05) were detected, irrespective of the post type. For GF and G/CF, all failures were considered mixed, while a predominance of adhesive failures was detected for CF. CONCLUSION: The bonding between fiber posts and luting agents was affected by the type of fibers and polymerization mode of the cement. When no surface treatment of the post is performed, the bonding between glass fiber post and dual-cured agent seems to be more reliable.

Preparation and characterization of Ti-15Mo alloy used as biomaterial

With the increase in life expectancy, biomaterials have become an increasingly important focus of research because they are used to replace parts and functions of the human body, thus contributing to improved quality of life. In the development of new biomaterials, the Ti-15Mo alloy is particularly significant. In this study, the Ti-15Mo alloy was produced using an arc-melting furnace and then characterized by density, X-ray diffraction, optical microscopy, hardness and dynamic elasticity modulus measurements, and cytotoxicity tests. The microstructure was obtained with β predominance. Microhardness, elasticity modulus, and cytotoxicity testing results showed that this material has great potential for use as biomaterial, mainly in orthopedic applications.