In vivo effects of a recombinant vaccinia virus expressing a mouse mammary tumor virus superantigen.

Early after infection, the mouse mammary tumor virus (MMTV) expresses a superantigen (SAg) at the surface of B lymphocytes. Interaction with the T-cell receptor Vbeta domain induces a polyclonal proliferative response of the SAg-reactive T cells. Stimulated T cells become anergic and are deleted from the T-cell repertoire. We have used a recombinant vaccinia virus encoding the MMTV(GR) SAg to dissect the effects of the retroviral SAg during an unrelated viral infection. Subcutaneous infection with this recombinant vaccinia virus induces a very rapid increase of Vbeta14 T cells in the draining lymph node. This stimulation does not require a large Plumber of infectious particles and is not strictly dependent on the expression of the major histocompatibility complex class II I-E molecule, as it is required after MMTV(GR) infection. In contrast to MMTV infection during which B cells are infected, we do not observe any clonal deletion of the reactive T cells following the initial stimulation phase. Our data show that contrary to the case with MMTV, macrophages but not B cells are the targets of infection by vaccinia virus in the lymph node, indicating the ability of these cells to present a retroviral SAg. The altered SAg expression in a different target cell observed during recombinant vaccinia virus infection therefore results in significant changes in the SAg response.

Expression of MYC, IgM, As Well As Non-Germinal Centre B-Cell Like Immunophenotype and Positive Immunofish Index Predict a Worse Progression Free Survival and Overall Survival in a Series of 670 De Novo Diffuse Large B-Cell Lymphomas Included in Clinical Trials: A GELA Study of the 2003 Program

Introduction: Diffuse large B-cell lymphomas (DLBCL) represent a heterogeneous disease with variable clinical outcome. Identifying phenotypic biomarkers of tumor cells on paraffin sections that predict different clinical outcome remain an important goal that may also help to better understand the biology of this lymphoma. Differentiating non-germinal centre B-cell-like (non-GCB) from Germinal Centre B-cell-like (GCB) DLBCL according to Hans algorithm has been considered as an important immunohistochemical biomarker with prognostic value among patients treated with R-CHOP although not reproducibly found by all groups. Gene expression studies have also shown that IgM expression might be used as a surrogate for the GCB and ABC subtypes with a strong preferential expression of IgM in ABC DLBCL subtype. ImmunoFISH index based on the differential expression of MUM-1, FOXP1 by immunohistochemistry and on the BCL6 rearrangement by FISH has been previously reported (C Copie-Bergman, J Clin Oncol. 2009;27:5573-9) as prognostic in an homogeneous series of DLBCL treated with R-CHOP. In addition, oncogenic MYC protein overexpression by immunohistochemistry may represent an easy tool to identify the consequences of MYC deregulation in DLBCL. Our aim was to analyse by immunohistochemistry the prognostic relevance of MYC, IgM, GCB/nonGCB subtype and ImmunoFISH index in a large series of de novo DLBCL treated with Rituximab (R)-chemotherapy (anthracyclin based) included in the 2003 program of the Groupe d'Etude des Lymphomes de l'Adulte (GELA) trials. Methods: The 2003 program included patients with de novo CD20+ DLBCL enrolled in 6 different LNH-03 GELA trials (LNH-03-1B, -B, -3B, 39B, -6B, 7B) stratifying patients according to age and age-adjusted IPI. Tumor samples were analyzed by immunohistochemistry using CD10, BCL6, MUM1, FOXP1 (according to Barrans threshold), MYC, IgM antibodies on tissue microarrays and by FISH using BCL6 split signal DNA probes. Considering evaluable Hans score, 670 patients were included in the study with 237 (35.4%) receiving intensive R-ACVBP regimen and 433 (64.6%) R-CHOP/R-mini-CHOP. Results: 304 (45.4%) DLBCL were classified as GCB and 366 (54.6%) as non-GCB according to Hans algorithm. 337/567 cases (59.4%) were positive for the ImmunoFISH index (i.e. two out of the three markers positive: MUM1 protein positive, FOXP1 protein Variable or Strong, BCL6 rearrangement). Immunofish index was preferentially positive in the non-GCB subtype (81.3%) compared to the GCB subtype (31.2%), (p<0.001). IgM was recorded as positive in tumor cells in 351/637 (52.4%) DLBCL cases with a preferential expression in non-GCB 195 (53.3%) vs GCB subtype 100(32.9%), p<0.001). MYC was positive in 170/577 (29.5%) cases with a 40% cut-off and in 44/577 (14.2%) cases with a cut-off of 70%. There was no preferential expression of MYC among GCB or non-GCB subtype (p>0.4) for both cut-offs. Progression-free Survival (PFS) was significantly worse among patients with high IPI score (p<0.0001), IgM positive tumor (p<0.0001), MYC positive tumor with a 40% threshold (p<0.001), ImmunoFISH positive index (p<0.002), non-GCB DLBCL subtype (p<0.0001). Overall Survival (OS) was also significantly worse among patients with high IPI score (p<0.0001), IgM positive tumor (p=0.02), MYC positive tumor with a 40% threshold (p<0.01), ImmunoFISH positive index (p=0.02), non-GCB DLBCL subtype (p<0.0001). All significant parameters were included in a multivariate analysis using Cox Model and in addition to IPI, only the GCB/non-GCB subtype according to Hans algorithm predicted significantly a worse PFS among non-GCB subgroup (HR 1.9 [1.3-2.8] p=0.002) as well as a worse OS (HR 2.0 [1.3-3.2], p=0.003). This strong prognostic value of non-GCB subtyping was confirmed considering only patients treated with R- CHOP for PFS (HR 2.1 [1.4-3.3], p=0.001) and for OS (HR 2.3 [1.3-3.8], p=0.002). Conclusion: Our study on a large series of patients included in trials confirmed the relevance of immunohistochemistry as a useful tool to identify significant prognostic biomarkers for clinical use. We show here that IgM and MYC might be useful prognostic biomarkers. In addition, we confirmed in this series the prognostic value of the ImmunoFISH index. Above all, we fully validated the strong and independent prognostic value of the Hans algorithm, daily used by the pathologists to subtype DLBCL.

Mico-cocktail validation for CYP3A and CYP2D6 assessment using a low dose of midazolam (0.075 mg) and dextromethorphan (2.5 mg)

Background/Aim: Cocktail approach is generally preferred to individual administration of probes in order to characterize the activity of multiple enzymes. However, cocktail strategy has several drawbacks such as drug-drug interactions, tolerability and toxicity. Hence, there is a need to develop cocktails using low doses of probes. Our aim was to investigate whether the simultaneous oral administration of microdoses of midazolam (MDZ) and dextromethorphan (DEM) can be used to assess the simultaneous activities of CYP3A and CYP2D6. Methods: As part of a 5 arm randomized cross-over control trial on the analgesic efficacy of oxycodone, ten healthy young non-smoking males received the following combinations of drugs: Quinidine (Q)+ ketoconazole (K) or Q+placebo (P) or K+P or P+P. In all cases MDZ (0.075 mg) and DEM (2.5 mg) were administrated 1 hour after Q, K or P. CYP2D6 and CYP3A activities were determined after urine collection during 8 hours (ratio DEM/DOR), and a blood sample (EDTA) after 30 min (ratio 1-OH-MDZ/MDZ). DEM and DOR analysis was performed using LC-fluorescence. MDZ and 1-OH-MDZ determination was performed using GC-MS. Allele's variants of CYP2D6 were detected using the AmpliChipTMCYP450 (Roche). Results: CYP2D6 genotype predicted 1 poor (PM), 1 intermediate (IM), 7 extensive (EM) and 2 ultra rapid (UM) metabolizers. A good correlation was obtained between the predicted and the measured phenotypes except for 1 EM phenotyped as UM. Two duplications for alleles *41/*41xN and *1/*2xN were detected and the two volunteers were phenotyped as UM. A potent inhibition of CYP2D6 or CYP3A4 was obtained when Q or K were used. Mean metabolic ratio DEM/DOR in P and K groups were 0.015 (±0.028) and 0.015 (±0.019). It significantly increased in Q and QK groups (0.668 (±0.676) and 0.743 (±1.038)). Mean 1-OH-MDZ/MDZ in P, Q were 2.73 (±1.05) and 2.55 (±1.40) while it significantly decreased in K and QK groups (0.11 (±0.05), 0.10 (±0.05)). Moreover, there were no statistically significant differences between QK and K sessions for CYP3A and between QK and Q for CYP2D6 which indicate that there is no interaction between the two metabolic pathways. Conclusion: Simultaneous assessment of CYP3A and CYP2D6 activities can be obtained by low oral doses (micro-cocktail) of MDZ and DEM. Specific inhibitors such as Q or K modulates selectively CYP2D6 or CYP3A activities.

Specific delineation of BK polyomavirus in kidney tissue with a digoxigenin-labeled DNA probe.

The detection of BK polyomavirus (BK virus, BKV) in kidney tissue is hampered by nonspecificity of antibodies suited to immunohistochemistry, and nonspecific background with in situ hybridization. The biotin-labeled DNA probe that is commercially available (Enzo Life Sciences, Inc.) shows good signal, but the intrinsic background in kidney tissue is high. We determined that the intrinsic background is due to endogenous biotin or biotin-binding activity in the renal tubular epithelium. Neither antibody blocking procedures nor an avidin/biotin block were entirely satisfactory for eliminating this background staining. We developed a digoxigenin-labeled DNA probe, and protocol, for detecting BK virus in formalin-fixed, paraffin embedded, kidney tissue obtained at autopsy. The hybridization signal is strong and there is no perceptible background staining. Eleven negative control kidneys all failed to hybridize. Conditions for low stringency hybridization may be employed, detecting both the related JC polyomavirus and BKV. Alternatively, high stringency hybridization conditions may be utilized, detecting BKV only. BK associated tubular necrosis is clearly demonstrated in two cases of BK nephritis.

Estrogen receptor level determines sex-specific in vitro transcription from the Xenopus vitellogenin promoter.

Female-specific expression of the Xenopus laevis vitellogenin gene was reconstituted in vitro by addition of recombinant vaccinia-virus-produced estrogen receptor to nuclear extracts from male livers, in which this gene is silent. Transcription enhancement was at least 30 times and was selectively restricted to vitellogenin templates containing the estrogen-responsive unit. Thus, in male hepatocytes, estrogen receptor is the limiting regulatory factor that in the female liver controls efficient and accurate sex-specific expression of the vitellogenin gene. Furthermore, the Xenopus liver factor B, which is essential in addition to the estrogen receptor for the activation of this gene, was successfully replaced in the Xenopus extract by purified human nuclear factor I, identifying factor B of Xenopus as a functional homolog of this well-characterized human transcription factor.

Identification and characterization of novel classes of macrophage migration inhibitory factor (MIF) inhibitors with distinct mechanisms of action.

Macrophage migration inhibitory factor (MIF), a proinflammatory cytokine, is considered an attractive therapeutic target in multiple inflammatory and autoimmune disorders. In addition to its known biologic activities, MIF can also function as a tautomerase. Several small molecules have been reported to be effective inhibitors of MIF tautomerase activity in vitro. Herein we employed a robust activity-based assay to identify different classes of novel inhibitors of the catalytic and biological activities of MIF. Several novel chemical classes of inhibitors of the catalytic activity of MIF with IC(50) values in the range of 0.2-15.5 microm were identified and validated. The interaction site and mechanism of action of these inhibitors were defined using structure-activity studies and a battery of biochemical and biophysical methods. MIF inhibitors emerging from these studies could be divided into three categories based on their mechanism of action: 1) molecules that covalently modify the catalytic site at the N-terminal proline residue, Pro(1); 2) a novel class of catalytic site inhibitors; and finally 3) molecules that disrupt the trimeric structure of MIF. Importantly, all inhibitors demonstrated total inhibition of MIF-mediated glucocorticoid overriding and AKT phosphorylation, whereas ebselen, a trimer-disrupting inhibitor, additionally acted as a potent hyperagonist in MIF-mediated chemotactic migration. The identification of biologically active compounds with known toxicity, pharmacokinetic properties, and biological activities in vivo should accelerate the development of clinically relevant MIF inhibitors. Furthermore, the diversity of chemical structures and mechanisms of action of our inhibitors makes them ideal mechanistic probes for elucidating the structure-function relationships of MIF and to further determine the role of the oligomerization state and catalytic activity of MIF in regulating the function(s) of MIF in health and disease.

Feasibility of RNA studies on illegitimate transcription for molecular characterization of splicing mutations in the ATP7B gene: a case report.

Approximately 520 Wilson disease-causing mutations in the ATP7B gene have been described to date. In this study we report DNA and RNA analyses carried out for molecular characterization of a consensus sequence splicing mutation found in homozygosity in a Swiss Wilson disease patient. RNA analysis of 1946 +6 T→C in both the peripheral lymphoblasts and liver resulted in the production in the propositus of only an alternative transcript lacking exons 6, 7, and 8 resulting most likely in alterations of cell biochemistry and disease. The patient presents an early form of severe hepatic disease characterized by hepatosplenomegaly, reduced hepatic function, anemia and thrombocytopenia indicating that 1946 +6 T→C is a severe mutation. Since identical results were obtained from both peripheral lymphoblasts and liver they also suggest that RNA studies of illegitimate transcripts can be safely used for molecular characterization of ATP7B splicing mutations, thus improving genetic counseling and diagnosis of Wilson disease. Moreover these studies, contribute to reveal the exact molecular mechanisms producing Wilson disease.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Sternal wound infection after heart operations in pediatric patients associated with nasal carriage of Staphylococcus aureus.

A cluster of six pediatric cases of deep-seated Staphylococcus aureus infection after heart operations prompted us to perform molecular typing of the S. aureus isolates by pulsed-field gel electrophoresis. This revealed the presence of genotypically distinct isolates in four of the six patients. Isolates of two patients were genotypically identical. All patients carried S. aureus in the anterior nares. In each patient, the banding pattern of deoxyribonucleic acid in these isolates was indistinguishable from that in strains isolated from blood or wound cultures. Molecular typing with pulsed-field gel electrophoresis ruled out nosocomial transmission of S. aureus between four patients; at the same time, it provided evidence for an association between nasal colonization and postoperative wound infection. Epidemiologic investigation of potential links between two patients with identical isolates did not provide any evidence for nosocomial transmission of S. aureus between these patients. Because nasal colonization with S. aureus may be a risk factor for surgical wound infection in pediatric patients undergoing heart operations, preoperative decolonization appears to be warranted.

The frequency and prognostic impact of dic(9;20)(p13.2;q11.2) in childhood B-cell precursor acute lymphoblastic leukemia: results from the NOPHO ALL-2000 trial.

The dic(9;20)(p13.2;q11.2) is reported to be present in ∼2% of childhood B-cell precursor acute lymphoblastic leukemia (BCP ALL). However, it easily escapes detection by G-banding analysis and its true prevalence is hence unknown. We performed interphase fluorescence in situ hybridization analyses-in a three-step manner-using probes for: (i) CDKN2A at 9p21, (ii) 20p and 20q subtelomeres and (iii) cen9 and cen20. Out of 1033 BCP ALLs diagnosed from 2001 to 2006, 533 were analyzed; 16% (84/533) displayed 9p21 deletions, of which 30% (25/84) had dic(9;20). Thus, dic(9;20)-positivity was found in 4.7% (25/533), making it the third most common genetic subgroup after high hyperdiploidy and t(12;21)(p13;q22). The dic(9;20) was associated with a female predominance and an age peak at 3 years; 18/25 (72%) were allocated to non-standard risk treatment at diagnosis. Including cases detected by G-banding alone, 29 dic(9;20)-positive cases were treated according to the NOPHO ALL 2000 protocol. Relapses occurred in 24% (7/29) resulting in a 5-year event-free survival of 0.69, which was significantly worse than for t(12;21) (0.87; P=0.002) and high hyperdiploidy (0.82; P=0.04). We conclude that dic(9;20) is twice as common as previously surmised, with many cases going undetected by G-banding analysis, and that dic(9;20) should be considered a non-standard risk abnormality.

Experience with angiotensin II antagonists in hypertensive patients.

1. The availability of orally active specific angiotensin receptor antagonists (AT1 antagonists) has opened new therapeutic choices and provided probes to test the specific role of the renin-angiotensin system in the pathogenesis of cardiovascular disease. 2. The data available so far suggest that the antihypertensive efficacy of angiotensin receptor antagonists is comparable to that of angiotensin-converting enzyme (ACE) inhibitors. This provides further evidence that this latter class of drugs exerts its effect mainly through blockade of the renin-angiotensin enzymatic cascade. As expected, the association of a diuretic exerts an equally strong additive effect to the antihypertensive efficacy of both classes of drugs. 3. The most common side effect of ACE inhibitors, dry cough, does not occur with AT1 antagonists, which confirms the long-held view that this untoward effect of the ACE inhibitors is due to renin-angiotensin-independent mechanisms. 4. Long-term studies with morbidity/mortality outcome results are needed, before a definite position can be assigned to this newcomer in the orchestra of modern antihypertensive drugs. Notwithstanding, this new class of agents already represents an exciting new addition to our therapeutic armamentarium.

Genetic diversity and relationship in American and African oil palm as revealed by RFLP and AFLP molecular markers

The objective of this work was to evaluate the genetic diversity, its organization and the genetic relationships within oil palm (Elaeis oleifera (Kunth) Cortés, from America, and E. guineensis (Jacq.), from Africa) germplasm using Restriction Fragment Length Polymorphism (RFLP) and Amplified Fragment Length Polymorphism (AFLP). In complement to a previous RFLP study on 241 E. oleifera accessions, 38 E. guineensis accessions were analyzed using the same 37 cDNA probes. These accessions covered a large part of the geographical distribution areas of these species in America and Africa. In addition, AFLP analysis was performed on a sub-set of 40 accessions of E. oleifera and 22 of E. guineensis using three pairs of enzyme/primer combinations. Data were subjected to Factorial Analysis of Correspondence (FAC) and cluster analysis, with parameters of genetic diversity being also studied. Results appeared congruent between RFLP and AFLP. In the E. oleifera, AFLP confirmed the strong structure of genetic diversity revealed by RFLP, according to geographical origin of the studied material, with the identification of the same four distinct genetic groups: Brazil, French Guyana/Surinam, Peru, north of Colombia/Central America. Both markers revealed that genetic divergence between the two species is of the same magnitude as that among provenances of E. oleifera. This finding is in discrepancy with the supposed early tertiary separation of the two species.

Polyethylene glycol and polyvinylpirrolidone effect on bacterial rRNA extraction and hybridization from cells exposed to tannins

In order to detect fluctuations in ruminal microbial populations due to forage tannins using 16S ribosomal RNA (rRNA) probes, recovery of intact rRNA is required. The objective of this work was to evaluate the effect of polyethylene glycol (PEG) and polyvinylpirrolidone (PVP) on extraction of bacterial rRNA, in the presence of tannins from tropical legume forages and other sources, that hybridize with oligonucleotide probes. Ruminococcus albus 8 cells were exposed to 8 g/L tannic acid or 1 g/L condensed tannins extracted from Acacia angustissima, banana (Musa sp.) skin, Desmodium ovalifolium, red grape (Vitis vinifera) skin and Inga edulis, or no tannins. Cells were rinsed with Tris buffer pH 7 containing either 8% PEG or 6% PVP prior to cell lysis. Total RNA samples rinsed with either PEG or PVP migrated through denaturing agarose gels. The 16S rRNA bands successfully hybridized with a R. albus species-specific oligonucleotide probe, regardless of tannin source. The effect of rinsing buffers on the density of 16S rRNA bands, as well as on the hybridization signals was compared. There were significant effects (P<0.01) when the controls were compared to either buffer treatments due to tannin type, buffer used and the interaction of tannin type and buffer. The significant interaction indicates the influence of tannin type on the parameters evaluated.

Synthesis of a non-peptidic PET tracer designed for α5β1 integrin receptor.

Arginine-glycine-aspartic acid (RGD)-containing peptides have been traditionally used as PET probes to noninvasively image angiogenesis, but recently, small selective molecules for α5 β1 integrin receptor have been developed with promising results. Sixty-one antagonists were screened, and tert-butyl (S)-3-(2-((3R,5S)-1-(3-(1-(2-fluoroethyl)-1H-1,2,3-triazol-4-yl)propanoyl)-5-((pyridin-2-ylamino)methyl)pyrrolidin-3-yloxy)acetamido)-2-(2,4,6-trimethylbenzamido)propanoate (FPMt) was selected for the development of a PET tracer to image the expression of α5 β1 integrin receptors. An alkynyl precursor (PMt) was initially synthesized in six steps, and its radiolabeling was performed according to the azide-alkyne copper(II)-catalyzed Huisgen's cycloaddition by using 1-azido-2-[(18)F]fluoroethane ([(18)F]12). Different reaction conditions between PMt and [(18)F]12 were investigated, but all of them afforded [(18)F]FPMt in 15 min with similar radiochemical yields (80-83%, decay corrected). Overall, the final radiopharmaceutical ([(18)F]FPMt) was obtained after a synthesis time of 60-70 min in 42-44% decay-corrected radiochemical yield.

A nuclear factor I-like activity and a liver-specific repressor govern estrogen-regulated in vitro transcription from the Xenopus laevis vitellogenin B1 promoter.

A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.